WormBase Tree Display for Variation: WBVar00248945
expand all nodes | collapse all nodes | view schema
WBVar00248945 | Evidence | Paper_evidence | WBPaper00004826 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | sy234 | ||||||
Other_name | F34D10.5.1:c.562C>T | |||||||
CE24940:p.Pro188Ser | ||||||||
HGVSg | CHROMOSOME_III:g.3746689C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F34D10 | ||||
Flanking_sequences | cctatgaccttctgtattccaggcgtccgt | cctacaaatgtgagcaatgcgagaagtcgt | ||||||
Mapping_target | F34D10 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00004826 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00030823 | |||||||
Laboratory | PS | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003033 | ||||||
Transcript | F34D10.5.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
HGVSc | F34D10.5.1:c.562C>T | |||||||
HGVSp | CE24940:p.Pro188Ser | |||||||
cDNA_position | 585 | |||||||
CDS_position | 562 | |||||||
Protein_position | 188 | |||||||
Exon_number | 6/8 | |||||||
Codon_change | Ccc/Tcc | |||||||
Amino_acid_change | P/S | |||||||
Genetics | Interpolated_map_position | III | -4.25433 | |||||
Mapping_data | In_2_point | 6152 | ||||||
Description | Phenotype (7) | |||||||
Phenotype_not_observed | WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype (2) | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00006052 | |||||||
WBPaper00003719 | ||||||||
Method | Substitution_allele |