WormBase Tree Display for Variation: WBVar00248942
expand all nodes | collapse all nodes | view schema
WBVar00248942 | Evidence | Paper_evidence | WBPaper00003566 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | sy217 | ||||||
Other_name | C09H6.2b.1:c.139C>T | |||||||
C09H6.2a.1:c.139C>T | ||||||||
CE27060:p.Gln47Ter | ||||||||
CE15610:p.Gln47Ter | ||||||||
HGVSg | CHROMOSOME_I:g.8119175G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | C09H6 | ||||
Flanking_sequences | gccggtggtggtgggggaggagagcaacaa | aagtcccatttcgttagttttacaagagatt | ||||||
Mapping_target | C09H6 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003566 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | PS | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00002999 | ||||||
Transcript | C09H6.2b.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | C09H6.2b.1:c.139C>T | |||||||
HGVSp | CE27060:p.Gln47Ter | |||||||
cDNA_position | 142 | |||||||
CDS_position | 139 | |||||||
Protein_position | 47 | |||||||
Exon_number | 2/17 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
C09H6.2a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C09H6.2a.1:c.139C>T | |||||||
HGVSp | CE15610:p.Gln47Ter | |||||||
cDNA_position | 140 | |||||||
CDS_position | 139 | |||||||
Protein_position | 47 | |||||||
Exon_number | 2/18 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Interactor | WBInteraction000555590 | |||||||
WBInteraction000555591 | ||||||||
Genetics | Interpolated_map_position | I | 2.55966 | |||||
Description | Phenotype | WBPhenotype:0000436 | Paper_evidence | WBPaper00003566 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | In the vulval precursor cells of lin-10 mutants, strong LET-23 staining was observed in the apical membrane domains and no LET-23 staining was observed in the basolateral membrane domains (unlike wild-type) | Paper_evidence | WBPaper00003566 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Staining with anti-LET-23 antibodies | Paper_evidence | WBPaper00003566 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001410 | Paper_evidence | WBPaper00003566 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Both 140- and 70-kDa bands are absent in protein extracts from lin-10(n299) and lin-10(sy217) mutants. | Paper_evidence | WBPaper00003566 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Western blotting experiments using anti-LIN-10 antibodies | Paper_evidence | WBPaper00003566 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed (2) | ||||||||
Reference | WBPaper00003566 | |||||||
Method | Substitution_allele |