WormBase Tree Display for Variation: WBVar00248908
expand all nodes | collapse all nodes | view schema
| WBVar00248908 | Evidence | Paper_evidence | WBPaper00001756 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name (3) | |||||||||
| Sequence_details | SMap | S_parent | Sequence | Y73B6A | |||||
| Flanking_sequences | acaattcttatctaaaacatttaattttca | ctagtgaaagaactctttgggatcgcatca | |||||||
| Mapping_target | Y73B6A | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001756 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00027280 | ||||||||
| WBStrain00030711 | |||||||||
| WBStrain00030713 | |||||||||
| WBStrain00030718 | |||||||||
| WBStrain00030812 | |||||||||
| Laboratory | PS | ||||||||
| Status | Live | ||||||||
| Affects (3) | |||||||||
| Genetics | Interpolated_map_position | IV | 3.22834 | ||||||
| Mapping_data | In_multi_point | 1641 | |||||||
| 1642 | |||||||||
| 1929 | |||||||||
| 3152 | |||||||||
| Description | Phenotype (11) | ||||||||
| Phenotype_not_observed | WBPhenotype:0001084 | Paper_evidence | WBPaper00003955 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00003955 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00003955 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0002193 | Paper_evidence | WBPaper00044058 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "No allele of egl-17, egl-15 or any other downstream FGF component other than sem-5 had any effect on orientation as single mutants (Table 1), which is probably due to the involvement of sem-5 in one of the other pathways controlling vulval orientation as well as its role in the FGF pathway." | Paper_evidence | WBPaper00044058 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006895 | PATO:0000460 | Paper_evidence | WBPaper00044058 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002378 | Paper_evidence | WBPaper00054670 | |||||||
| Curator_confirmed | WBPerson2706 | ||||||||
| Remark | animals avoid OP50 lawns contaminated with Microbacterium nematophilum as wild type | Paper_evidence | WBPaper00054670 | ||||||
| Curator_confirmed | WBPerson2706 | ||||||||
| Reference (20) | |||||||||
| Method | Substitution_allele |
