WormBase Tree Display for Variation: WBVar00248884
expand all nodes | collapse all nodes | view schema
WBVar00248884 | Evidence | Paper_evidence | WBPaper00001404 | ||||||
---|---|---|---|---|---|---|---|---|---|
Person_evidence | WBPerson625 | ||||||||
Name | Public_name | sy1 | |||||||
Other_name | CE03840:p.Gln1318Ter | ||||||||
ZK1067.1a.1:c.3952C>T | |||||||||
ZK1067.1d.1:c.3988C>T | |||||||||
CE50411:p.Gln1330Ter | |||||||||
CE42910:p.Gln1323Ter | |||||||||
CE42891:p.Gln1257Ter | |||||||||
ZK1067.1c.1:c.3967C>T | |||||||||
ZK1067.1b.1:c.3769C>T | |||||||||
HGVSg | CHROMOSOME_II:g.9206918C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK1067 | |||||
Flanking_sequences | gcagttcaatatgaaaatgaagaagtatca | aaaaggaaacttgtctttaacttttcgaac | |||||||
Mapping_target | ZK1067 | ||||||||
Type_of_mutation | Substitution | C | T | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030806 | ||||||||
WBStrain00030807 | |||||||||
WBStrain00030808 | |||||||||
WBStrain00030820 | |||||||||
WBStrain00030836 | |||||||||
Component_of_genotype | WBGenotype00000109 | ||||||||
WBGenotype00000110 | |||||||||
WBGenotype00000111 | |||||||||
WBGenotype00000112 | |||||||||
WBGenotype00000113 | |||||||||
WBGenotype00000114 | |||||||||
Laboratory | PS | ||||||||
Author | Sternberg P | ||||||||
Aroian R | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002299 | |||||||
Transcript | ZK1067.1d.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1d.1:c.3988C>T | ||||||||
HGVSp | CE50411:p.Gln1330Ter | ||||||||
cDNA_position | 3994 | ||||||||
CDS_position | 3988 | ||||||||
Protein_position | 1330 | ||||||||
Exon_number | 20/21 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK1067.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1b.1:c.3769C>T | ||||||||
HGVSp | CE42891:p.Gln1257Ter | ||||||||
cDNA_position | 3769 | ||||||||
CDS_position | 3769 | ||||||||
Protein_position | 1257 | ||||||||
Exon_number | 16/16 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK1067.1c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1c.1:c.3967C>T | ||||||||
HGVSp | CE42910:p.Gln1323Ter | ||||||||
cDNA_position | 3967 | ||||||||
CDS_position | 3967 | ||||||||
Protein_position | 1323 | ||||||||
Exon_number | 18/19 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK1067.1a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1a.1:c.3952C>T | ||||||||
HGVSp | CE03840:p.Gln1318Ter | ||||||||
cDNA_position | 4041 | ||||||||
CDS_position | 3952 | ||||||||
Protein_position | 1318 | ||||||||
Exon_number | 19/20 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (13) | |||||||||
Isolation | Mutagen | EMS | |||||||
Forward_genetics | F2 standard screen for non-Muv | ||||||||
Genetics | Interpolated_map_position | II | 1.09466 | ||||||
Mapping_data | In_multi_point | 3220 | |||||||
3221 | |||||||||
3222 | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence (2) | ||||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed (2) | |||||||||
Remark | Displays intragenic complementation with sy97 for this phenotype, i.e., 53% of sy1/sy97 animals are not Egl. | Paper_evidence | WBPaper00001404 | ||||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Incomplete | Only 8% of animals are not Egl. | Paper_evidence | WBPaper00001404 | |||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Paper_evidence | WBPaper00001404 | |||||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001404 | ||||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000219 | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0001708 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00002811 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002811 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000698 | Paper_evidence (4) | ||||||||
Person_evidence | WBPerson625 | ||||||||
WBPerson261 | |||||||||
Curator_confirmed (3) | |||||||||
Remark | Phenotype is not suppressed by sy322. | Paper_evidence | WBPaper00002375 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
LET-23::GFP efficiently rescued the let-23(sy1) vulvaless (Vul) phenotype | Paper_evidence | WBPaper00045219 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Figure 1B | Paper_evidence | WBPaper00005277 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 14% (n=30). | Paper_evidence | WBPaper00001404 | |||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Paper_evidence | WBPaper00001404 | |||||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
Rescued_by_transgene | WBTransgene00020283 | ||||||||
WBTransgene00019945 | |||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001404 | ||||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | scored by Normarski | Paper_evidence | WBPaper00001404 | |||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00027035 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Therefore, we introduced deIs1 and deIs4 into a strain containing let-23(sy1),a loss-of-function mutation for the LET-23 receptor tyrosine kinase that compromises Ras signaling in the VPCs (Aroian and Sternberg, 1991). We analyzed the levels of GFP expression in P5.p-P8.p before and after vulval induction in let-23(sy1); deIs4 and let-23(sy1); deIs1 animals and observed no significant (P < 0.01) upregulation in P6.p after vulval induction (Figs. 5B and 6B and data not shown). Therefore, the transcriptional upregulation of lin-39 in P6.p is dependent on Ras signaling." | Paper_evidence | WBPaper00027035 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006894 | PATO:0000460 | Paper_evidence | WBPaper00027035 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | deIs1 [lin-39::GFP] | Paper_evidence | WBPaper00027035 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
deIs4 [lin-39::GFP] | Paper_evidence | WBPaper00027035 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00001404 | ||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | viable | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have 100% wild-type P12 as homozygotes. Animals exhibit low levels of P12-P11 cell transformations when in trans to other let-23 alleles. | Paper_evidence | WBPaper00001404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00001404 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000443 | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00057074 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | neurons did not show a loss in unc-25::GFP expression | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014913 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005027 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005021 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (32) | |||||||||
Remark | Isolated as suppressor of the Multivulva phenotype of lin-15(n309) in 1987 | Person_evidence | WBPerson625 | ||||||
WBPerson26 | |||||||||
Method | Substitution_allele |