WormBase Tree Display for Variation: WBVar00248884
expand all nodes | collapse all nodes | view schema
WBVar00248884 | Evidence | Paper_evidence | WBPaper00001404 | ||
---|---|---|---|---|---|
Person_evidence | WBPerson625 | ||||
Name | Public_name | sy1 | |||
Other_name | CE03840:p.Gln1318Ter | ||||
ZK1067.1a.1:c.3952C>T | |||||
ZK1067.1d.1:c.3988C>T | |||||
CE50411:p.Gln1330Ter | |||||
CE42910:p.Gln1323Ter | |||||
CE42891:p.Gln1257Ter | |||||
ZK1067.1c.1:c.3967C>T | |||||
ZK1067.1b.1:c.3769C>T | |||||
HGVSg | CHROMOSOME_II:g.9206918C>T | ||||
Sequence_details | SMap | S_parent | Sequence | ZK1067 | |
Flanking_sequences | gcagttcaatatgaaaatgaagaagtatca | aaaaggaaacttgtctttaacttttcgaac | |||
Mapping_target | ZK1067 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00030806 | ||||
WBStrain00030807 | |||||
WBStrain00030808 | |||||
WBStrain00030820 | |||||
WBStrain00030836 | |||||
Component_of_genotype | WBGenotype00000109 | ||||
WBGenotype00000110 | |||||
WBGenotype00000111 | |||||
WBGenotype00000112 | |||||
WBGenotype00000113 | |||||
WBGenotype00000114 | |||||
Laboratory | PS | ||||
Author | Sternberg P | ||||
Aroian R | |||||
Status | Live | ||||
Affects | Gene | WBGene00002299 | |||
Transcript | ZK1067.1d.1 | VEP_consequence | stop_gained | ||
VEP_impact | HIGH | ||||
HGVSc | ZK1067.1d.1:c.3988C>T | ||||
HGVSp | CE50411:p.Gln1330Ter | ||||
cDNA_position | 3994 | ||||
CDS_position | 3988 | ||||
Protein_position | 1330 | ||||
Exon_number | 20/21 | ||||
Codon_change | Caa/Taa | ||||
Amino_acid_change | Q/* | ||||
ZK1067.1b.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | ZK1067.1b.1:c.3769C>T | ||||
HGVSp | CE42891:p.Gln1257Ter | ||||
cDNA_position | 3769 | ||||
CDS_position | 3769 | ||||
Protein_position | 1257 | ||||
Exon_number | 16/16 | ||||
Codon_change | Caa/Taa | ||||
Amino_acid_change | Q/* | ||||
ZK1067.1c.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | ZK1067.1c.1:c.3967C>T | ||||
HGVSp | CE42910:p.Gln1323Ter | ||||
cDNA_position | 3967 | ||||
CDS_position | 3967 | ||||
Protein_position | 1323 | ||||
Exon_number | 18/19 | ||||
Codon_change | Caa/Taa | ||||
Amino_acid_change | Q/* | ||||
ZK1067.1a.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | ZK1067.1a.1:c.3952C>T | ||||
HGVSp | CE03840:p.Gln1318Ter | ||||
cDNA_position | 4041 | ||||
CDS_position | 3952 | ||||
Protein_position | 1318 | ||||
Exon_number | 19/20 | ||||
Codon_change | Caa/Taa | ||||
Amino_acid_change | Q/* | ||||
Interactor (13) | |||||
Isolation | Mutagen | EMS | |||
Forward_genetics | F2 standard screen for non-Muv | ||||
Genetics | Interpolated_map_position | II | 1.09466 | ||
Mapping_data | In_multi_point | 3220 | |||
3221 | |||||
3222 | |||||
Description (2) | |||||
Reference (32) | |||||
Remark | Isolated as suppressor of the Multivulva phenotype of lin-15(n309) in 1987 | Person_evidence | WBPerson625 | ||
WBPerson26 | |||||
Method | Substitution_allele |