WormBase Tree Display for Variation: WBVar00248884
expand all nodes | collapse all nodes | view schema
WBVar00248884 | Evidence | Paper_evidence | WBPaper00001404 | ||||||
---|---|---|---|---|---|---|---|---|---|
Person_evidence | WBPerson625 | ||||||||
Name | Public_name | sy1 | |||||||
Other_name | CE03840:p.Gln1318Ter | ||||||||
ZK1067.1a.1:c.3952C>T | |||||||||
ZK1067.1d.1:c.3988C>T | |||||||||
CE50411:p.Gln1330Ter | |||||||||
CE42910:p.Gln1323Ter | |||||||||
CE42891:p.Gln1257Ter | |||||||||
ZK1067.1c.1:c.3967C>T | |||||||||
ZK1067.1b.1:c.3769C>T | |||||||||
HGVSg | CHROMOSOME_II:g.9206918C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK1067 | |||||
Flanking_sequences | gcagttcaatatgaaaatgaagaagtatca | aaaaggaaacttgtctttaacttttcgaac | |||||||
Mapping_target | ZK1067 | ||||||||
Type_of_mutation | Substitution | C | T | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030806 | ||||||||
WBStrain00030807 | |||||||||
WBStrain00030808 | |||||||||
WBStrain00030820 | |||||||||
WBStrain00030836 | |||||||||
Component_of_genotype | WBGenotype00000109 | ||||||||
WBGenotype00000110 | |||||||||
WBGenotype00000111 | |||||||||
WBGenotype00000112 | |||||||||
WBGenotype00000113 | |||||||||
WBGenotype00000114 | |||||||||
Laboratory | PS | ||||||||
Author | Sternberg P | ||||||||
Aroian R | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002299 | |||||||
Transcript | ZK1067.1d.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1d.1:c.3988C>T | ||||||||
HGVSp | CE50411:p.Gln1330Ter | ||||||||
cDNA_position | 3994 | ||||||||
CDS_position | 3988 | ||||||||
Protein_position | 1330 | ||||||||
Exon_number | 20/21 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK1067.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1b.1:c.3769C>T | ||||||||
HGVSp | CE42891:p.Gln1257Ter | ||||||||
cDNA_position | 3769 | ||||||||
CDS_position | 3769 | ||||||||
Protein_position | 1257 | ||||||||
Exon_number | 16/16 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK1067.1c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1c.1:c.3967C>T | ||||||||
HGVSp | CE42910:p.Gln1323Ter | ||||||||
cDNA_position | 3967 | ||||||||
CDS_position | 3967 | ||||||||
Protein_position | 1323 | ||||||||
Exon_number | 18/19 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK1067.1a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1a.1:c.3952C>T | ||||||||
HGVSp | CE03840:p.Gln1318Ter | ||||||||
cDNA_position | 4041 | ||||||||
CDS_position | 3952 | ||||||||
Protein_position | 1318 | ||||||||
Exon_number | 19/20 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (13) | |||||||||
Isolation | Mutagen | EMS | |||||||
Forward_genetics | F2 standard screen for non-Muv | ||||||||
Genetics | Interpolated_map_position | II | 1.09466 | ||||||
Mapping_data | In_multi_point | 3220 | |||||||
3221 | |||||||||
3222 | |||||||||
Description | Phenotype (5) | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00001404 | ||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | viable | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have 100% wild-type P12 as homozygotes. Animals exhibit low levels of P12-P11 cell transformations when in trans to other let-23 alleles. | Paper_evidence | WBPaper00001404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00001404 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000443 | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00057074 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | neurons did not show a loss in unc-25::GFP expression | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014913 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term (2) | ||||||||
Reference (32) | |||||||||
Remark | Isolated as suppressor of the Multivulva phenotype of lin-15(n309) in 1987 | Person_evidence | WBPerson625 | ||||||
WBPerson26 | |||||||||
Method | Substitution_allele |