WormBase Tree Display for Variation: WBVar00248856
expand all nodes | collapse all nodes | view schema
| WBVar00248856 | Evidence | Paper_evidence | WBPaper00030711 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | su177 | |||||
| Other_name | C06A5.7a.2:c.20+1G>A | ||||||
| C06A5.7a.1:c.20+1G>A | |||||||
| HGVSg | CHROMOSOME_I:g.6000754C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | C06A5 | |||
| Flanking_sequences | gccatcagcgatgagtcaggctaaaactga | taagttatgatttctttaaatttagtaaaa | |||||
| Mapping_target | C06A5 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00032351 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00008394 | ||||||
| Laboratory | HE | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006823 | |||||
| WBGene00305255 | |||||||
| Transcript | C06A5.13 | ||||||
| C06A5.7a.2 | VEP_consequence | splice_donor_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | C06A5.7a.2:c.20+1G>A | ||||||
| Intron_number | 2/11 | ||||||
| C06A5.7a.1 | VEP_consequence | splice_donor_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | C06A5.7a.1:c.20+1G>A | ||||||
| Intron_number | 3/12 | ||||||
| Genetics | Interpolated_map_position | I | 0.664512 | ||||
| Mapping_data | In_2_point | 391 | |||||
| In_multi_point | 310 | ||||||
| 311 | |||||||
| 312 | |||||||
| Description | Phenotype | WBPhenotype:0000154 | Paper_evidence | WBPaper00032351 | |||
| Curator_confirmed | WBPerson1754 | ||||||
| WBPhenotype:0000553 | Paper_evidence | WBPaper00032351 | |||||
| Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPerson1754 | |||||||
| Remark | abnormal patchy muscle birefringence and ultrastructure | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000643 | Paper_evidence | WBPaper00032351 | |||||
| Curator_confirmed | WBPerson1754 | ||||||
| WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | slow, especially in adult | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000904 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | abnormal patchy muscle birefringence and ultrastructure | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001889 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | collections of thin and intermediate' filaments (no staining with anti-intermediate filament antibodies) | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0002131 | Paper_evidence | WBPaper00032351 | |||||
| Curator_confirmed | WBPerson1754 | ||||||
| Reference | WBPaper00030711 | ||||||
| WBPaper00032351 | |||||||
| Method | Substitution_allele |
