WormBase Tree Display for Variation: WBVar00248855
expand all nodes | collapse all nodes | view schema
WBVar00248855 | Evidence | Paper_evidence | WBPaper00005824 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | su158 | |||||||
Other_name | CE20549:p.Ile31ThrfsTer46 | ||||||||
C38C3.5.1:c.92_290del | |||||||||
HGVSg | CHROMOSOME_V:g.1477340_1478037del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C38C3 | |||||
Flanking_sequences | cgaaaaaaaataaatcaaaaaataatcaga | gtgagtttcaacattgaaatattacacata | |||||||
Mapping_target | C38C3 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00029953 | ||||||||
Laboratory | HE | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006794 | |||||||
Transcript | C38C3.5.1 (11) | ||||||||
Interactor | WBInteraction000520189 | ||||||||
Genetics | Interpolated_map_position | V | -18.8758 | ||||||
Description | Phenotype | WBPhenotype:0000643 | Paper_evidence | WBPaper00005824 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | shows a more severe motility defect than a strong loss-of-function mutant e677 | Paper_evidence | WBPaper00005824 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001213 | Paper_evidence | WBPaper00032057 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were nearly paralyzed. Motility (organization) was rescued by GFP-UNC-60B(WT) and largely by GFP-UNC-60B(deletion 152), but not by GFP-UNC-60B(deletion 150). | Paper_evidence | WBPaper00032057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00032057 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001570 | Paper_evidence | WBPaper00032057 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals had disorganized actin filaments with large aggregates in the body-wall muscle, demonstrated by tetramethylrhodamine-phalloidin staining of F-actin. Actin striation (organization) was rescued by GFP-UNC-60B(WT) but not by GFP-UNC-60B(deletion 150) and only partially by GFP-UNC-60B(deletion 152). | Paper_evidence | WBPaper00032057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00032057 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001587 | Paper_evidence | WBPaper00041203 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Homozygotes had severely disorganized actin filaments with formation of actin aggregates in the body wall muscle. | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00041203 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00041203 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0005884 | PATO:0000937 | Paper_evidence | WBPaper00041203 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001930 | Paper_evidence | WBPaper00032907 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were isolated based on altered or fewer muscle arms, observed by an altered pattern of trIs25 reporter expression, which expresses membrane-anchored YFP in select muscles of only the distal row of body wall muscles. | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00005824 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00005824 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00041203 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | CAS-1 subcellular localization was not disturbed in the unc-60B-null mutant. CAS-1 remained associated with striated myofibrils. | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000666 | Paper_evidence | WBPaper00032057 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000668 | Paper_evidence | WBPaper00032057 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No endomitotic oocytes were detected in the proximal gonad (n=50). | Paper_evidence | WBPaper00032057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001354 | Paper_evidence | WBPaper00032057 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Actin filaments were nearly normally organized into a non-striated meshwork in the myoepithelial-sheath cells. As by tetramethylrhodamine-phalloidin staining of F-actin. | Paper_evidence | WBPaper00032057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005828 | PATO:0000460 | Paper_evidence | WBPaper00032057 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001587 | Paper_evidence | WBPaper00032057 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There was no major difference in actin organization in the myoepithelial sheath cells compared to wild type animals, as assayed by tetramethylrhodamine-phalloidin staining of F-actin. | Paper_evidence | WBPaper00032057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005828 | PATO:0000460 | Paper_evidence | WBPaper00032057 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00041203 | ||||||||
WBPaper00032446 | |||||||||
WBPaper00032907 | |||||||||
WBPaper00005824 | |||||||||
WBPaper00032057 | |||||||||
Remark | Flanking sequences are 30 bp to the left of the start of 3B and 30 bp to the right of the end of 4B as no precise coordinates are specified in paper | Curator_confirmed | WBPerson1845 | ||||||
su158 is a null of unc-60B and has a deletion of 600 bp that completely removes exons 3B and 4B and does not disturb the unc-60A region | Paper_evidence | WBPaper00005824 | |||||||
Method | Deletion_allele |