WormBase Tree Display for Variation: WBVar00242710
expand all nodes | collapse all nodes | view schema
WBVar00242710 | Evidence | Paper_evidence | WBPaper00001835 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | sc103 | ||||||
Other_name | CE02104:p.Gln48Ter | |||||||
B0491.2.2:c.142C>T | ||||||||
B0491.2.1:c.142C>T | ||||||||
HGVSg | CHROMOSOME_II:g.11337561G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | B0491 | ||||
Flanking_sequences | tttgaattttaaataatttttaattttctag | aatctaccaatggattgtggaaggacatagt | ||||||
Mapping_target | B0491 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00001835 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00003804 | |||||||
WBStrain00005822 | ||||||||
Laboratory | BE | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00005016 | ||||||
Transcript | B0491.2.2 | VEP_consequence | stop_gained,splice_region_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | B0491.2.2:c.142C>T | |||||||
HGVSp | CE02104:p.Gln48Ter | |||||||
cDNA_position | 157 | |||||||
CDS_position | 142 | |||||||
Protein_position | 48 | |||||||
Exon_number | 4/5 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
B0491.2.1 | VEP_consequence | stop_gained,splice_region_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0491.2.1:c.142C>T | |||||||
HGVSp | CE02104:p.Gln48Ter | |||||||
cDNA_position | 174 | |||||||
CDS_position | 142 | |||||||
Protein_position | 48 | |||||||
Exon_number | 4/5 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Interactor | WBInteraction000501830 | |||||||
Genetics | Interpolated_map_position | II | 3.44065 | |||||
Description | Phenotype | WBPhenotype:0000501 | Paper_evidence | WBPaper00000906 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Left roller as transheterozygote with sc13 but not sc97, sc99, sc101 or e1350. | Paper_evidence | WBPaper00000906 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000906 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Dumpy as transheterozyogte with e1350, but not sc97, sc99, sc101 or sc13. Weak dumpy over Df. | Paper_evidence | WBPaper00000906 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000886 | Paper_evidence | WBPaper00000906 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Psuedo wild-type. WT as homozygote and heterozygote. | Paper_evidence | WBPaper00000906 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00027237 | |||||||
WBPaper00001328 | ||||||||
WBPaper00000906 | ||||||||
Method | Substitution_allele |