WormBase Tree Display for Variation: WBVar00242670
expand all nodes | collapse all nodes | view schema
WBVar00242670 | Name | Public_name | sc8 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F23H12.4b.1:c.674G>A | ||||||||
CE05707:p.Gly291Glu | |||||||||
F23H12.4a.1:c.872G>A | |||||||||
CE46560:p.Gly225Glu | |||||||||
HGVSg | CHROMOSOME_V:g.12354046G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F23H12 | |||||
Flanking_sequences | tgtaatatttcaggtattgcgctctcgatg | aggagtcttcttcgaggacggaaccagacg | |||||||
Mapping_target | F23H12 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024637 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00000253 | ||||||||
WBStrain00003786 | |||||||||
WBStrain00005521 | |||||||||
WBStrain00008019 | |||||||||
WBStrain00022738 | |||||||||
WBStrain00022749 | |||||||||
WBStrain00023555 | |||||||||
WBStrain00027209 | |||||||||
WBStrain00029194 | |||||||||
Laboratory | BE | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00005018 | |||||||
Transcript | F23H12.4a.1 (12) | ||||||||
F23H12.4b.1 (12) | |||||||||
Interactor | WBInteraction000052482 | ||||||||
WBInteraction000052494 | |||||||||
WBInteraction000052498 | |||||||||
WBInteraction000052512 | |||||||||
WBInteraction000052514 | |||||||||
WBInteraction000052519 | |||||||||
WBInteraction000052543 | |||||||||
WBInteraction000052552 | |||||||||
WBInteraction000519640 | |||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00024637 | |||||
Genetics | Interpolated_map_position | V | 4.00901 | ||||||
Mapping_data | In_2_point | 255 | |||||||
305 | |||||||||
849 | |||||||||
850 | |||||||||
851 | |||||||||
3129 | |||||||||
In_multi_point (25) | |||||||||
In_pos_neg_data | 1758 | ||||||||
Description | Phenotype | WBPhenotype:0000501 | Paper_evidence | WBPaper00000465 | |||||
WBPaper00000906 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Also, weak roller in Dauer stage. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
adults and L4 larvae left-handed rollers, easy to score (ES3) in adult | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
WBPaper00000906 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16C, 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
20C, 25C | Paper_evidence | WBPaper00000906 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000906 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Weak dumpy as transheterozygote with e24 at 25C not 20C. | Paper_evidence | WBPaper00000906 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00000906 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001516 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Alae make 1/2 turn along the length of the animal. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Annulae slightly deranged. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16C, 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001515 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001687 | Paper_evidence | WBPaper00001280 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not show any level of immunofluorescence significantly higher than wild-type controls. | Paper_evidence | WBPaper00001280 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00001328 | ||||||||
WBPaper00000465 | |||||||||
WBPaper00013885 | |||||||||
WBPaper00001280 | |||||||||
WBPaper00000906 | |||||||||
Method | Substitution_allele |