WormBase Tree Display for Variation: WBVar00242605
expand all nodes | collapse all nodes | view schema
| WBVar00242605 | Evidence | Paper_evidence | WBPaper00030754 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | sa684 | |||||
| Other_name (34) | |||||||
| HGVSg | CHROMOSOME_IV:g.12782806_12782807delinsAA | ||||||
| Sequence_details | SMap | S_parent | Sequence | ZK897 | |||
| Flanking_sequences | aaaacttctaaaaatatttatttcagggtt | ttctcacctggtcaagcatttgttctggaa | |||||
| Mapping_target | ZK897 | ||||||
| Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00030754 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | JT | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006767 | |||||
| Transcript (17) | |||||||
| Genetics | Interpolated_map_position | IV | 6.32118 | ||||
| Description | Phenotype | WBPhenotype:0001410 | Paper_evidence | WBPaper00030754 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | As assayed by the absence of a signal on a Western blot probed with an antibody generated against aa 42-304 of UNC-31. | Paper_evidence | WBPaper00030754 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00030754 | ||||||
| Remark | sa684 comprises a mutation of W797 to either an opal (tga) or an amber (tag) stop codon. | Paper_evidence | WBPaper00030754 | ||||
| Method | Substitution_allele |
