WormBase Tree Display for Variation: WBVar00242584
expand all nodes | collapse all nodes | view schema
WBVar00242584 | Evidence | Paper_evidence | WBPaper00026767 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sa513 | |||||||
Other_name | CE32438:p.Ser159Ter | ||||||||
F55B12.5.1:c.476C>G | |||||||||
HGVSg | CHROMOSOME_V:g.13829196C>G | ||||||||
Sequence_details | SMap | S_parent | Sequence | F55B12 | |||||
Flanking_sequences | ccgtttgcaacgtaactcattccgaacttt | actggtgtttccacctggatcaagtttgtc | |||||||
Mapping_target | F55B12 | ||||||||
Type_of_mutation | Substitution | c | g | Paper_evidence | WBPaper00026767 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022798 | ||||||||
Laboratory | JT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003812 | |||||||
Transcript | F55B12.5.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F55B12.5.1:c.476C>G | ||||||||
HGVSp | CE32438:p.Ser159Ter | ||||||||
cDNA_position | 478 | ||||||||
CDS_position | 476 | ||||||||
Protein_position | 159 | ||||||||
Exon_number | 4/11 | ||||||||
Codon_change | tCa/tGa | ||||||||
Amino_acid_change | S/* | ||||||||
Genetics | Interpolated_map_position | V | 5.67658 | ||||||
Description | Phenotype | WBPhenotype:0000303 | Paper_evidence | WBPaper00045871 | |||||
Curator_confirmed | WBPerson1869 | ||||||||
Remark | nrf-5(sa513) mutant has defect in chemoattraction to 2,3 butanedione (diacetyl) and isoamyl alcohol | Paper_evidence | WBPaper00045871 | ||||||
Curator_confirmed | WBPerson1869 | ||||||||
Affected_by | Molecule | WBMol:00002819 | Paper_evidence | WBPaper00045871 | |||||
Curator_confirmed | WBPerson1869 | ||||||||
WBPhenotype:0000304 | Paper_evidence | WBPaper00045871 | |||||||
Curator_confirmed | WBPerson1869 | ||||||||
Remark | nrf-5(sa513) mutant has defect in chemoattraction to 2,3 butanedione (diacetyl) and isoamyl alcohol | Paper_evidence | WBPaper00045871 | ||||||
Curator_confirmed | WBPerson1869 | ||||||||
Affected_by | Molecule | WBMol:00001063 | Paper_evidence | WBPaper00045871 | |||||
Curator_confirmed | WBPerson1869 | ||||||||
WBPhenotype:0001911 | Paper_evidence | WBPaper00046306 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | Table S2 | Paper_evidence | WBPaper00046306 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
WBPhenotype:0002365 | Paper_evidence | WBPaper00046306 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | Table S1 | Paper_evidence | WBPaper00046306 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
Phenotype_not_observed | WBPhenotype:0000243 | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | No persistent corpses in the pharynx of L1 (Supplemental Table 1) | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002486 | Paper_evidence | WBPaper00050421 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Mutations in genes within the ced-1/6/7 pathway (ced-1, ced-7, nrf-5, ttr-52), the ced-2/5/12 pathway (ced-2, ced-5), or both pathways (ced-1;ced-2 and ced-7;ced-5) did not cause PGC lobes to persist in L1 larvae (Supplementary Table 1), indicating that ced-10 functions in PGC lobe scission in a different context than it does in cell corpse engulfment." (PGC = 'primordial germ cell') | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004576 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004575 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | All strains include the xnIs360 or xnSi1 transgenes to visualize PGC membranes. | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00004883 | ||||||||
WBPaper00045871 | |||||||||
WBPaper00046306 | |||||||||
WBPaper00050421 | |||||||||
Method | Substitution_allele |