WormBase Tree Display for Variation: WBVar00242564
expand all nodes | collapse all nodes | view schema
WBVar00242564 | Evidence | Paper_evidence | WBPaper00035158 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | sa330 | ||||||
Other_name (8) | ||||||||
HGVSg | CHROMOSOME_V:g.10468980C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F22E12 | ||||
Flanking_sequences | agtcaaccatcttcttctacagctgtttta | agtgtacatattgtggaagctcgtgcacatc | ||||||
Mapping_target | F22E12 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00000635 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | JT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001178 | ||||||
Transcript (5) | ||||||||
Genetics | Interpolated_map_position | V | 2.56523 | |||||
Description | Phenotype | WBPhenotype:0000011 | Paper_evidence | WBPaper00004902 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | When exposed to 1 mol of cyanide gas (HCN) in a sealed chamber, wild-type worms exhibited a gradual slowing of movement, and more than 85% of the worms became fully immobile and unresponsive to touch by 5 h after exposure began. By 10 h all of the worms were immobile and unresponsive. In contrast, although mutant egl-9 worms exhibited a sluggishness similar to that of wild-type worms soon after cyanide exposure began, they recovered completely within a few hours and remained fully viable. Exposure to an increased amount of cyanide (4 mol) killed both egl-9 and wild-type worms with indistinguishable kinetics | Paper_evidence | WBPaper00004902 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004572 | Paper_evidence | WBPaper00004902 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000135 | Paper_evidence | WBPaper00035158 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-9 mutation caused over-expression of Pnhr-57::GFP | Paper_evidence | WBPaper00035158 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | nhr-57p::GFP | Paper_evidence | WBPaper00035158 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001014 | Paper_evidence | WBPaper00003860 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are resistant to paralysis by infection with P. aeruginosa PAO1. | Paper_evidence | WBPaper00003860 | |||||
Curator_confirmed | WBPerson712 | |||||||
Rescued_by_transgene | WBTransgene00019769 | |||||||
WBTransgene00019768 | ||||||||
WBTransgene00019767 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00035158 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-9 allele severely disabled oxygen-dependent degradation of HIF-1 | Paper_evidence | WBPaper00035158 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Western blots | Paper_evidence | WBPaper00035158 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0000006 | Paper_evidence | WBPaper00035158 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | sa330 did not cause egg-laying defects | Paper_evidence | WBPaper00035158 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00003860 | |||||||
WBPaper00035158 | ||||||||
WBPaper00004902 | ||||||||
Method | Substitution_allele |