WormBase Tree Display for Variation: WBVar00242520
expand all nodes | collapse all nodes | view schema
WBVar00242520 | Evidence | Paper_evidence | WBPaper00002315 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | sa201 | ||||||
Other_name | F09B12.6.1:c.742G>A | |||||||
CE26710:p.Gly248Arg | ||||||||
HGVSg | CHROMOSOME_X:g.15091568G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F09B12 | ||||
Flanking_sequences | attaacgaagttatctattttagggctctg | gatgtacgttcattgaaatgttattaaaac | ||||||
Mapping_target | F09B12 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | JT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001468 | ||||||
Transcript | F09B12.6.1 (12) | |||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | X | 21.8364 | |||||
Mapping_data | In_multi_point | 3258 | ||||||
3259 | ||||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | slow growing | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000209 | Paper_evidence | WBPaper00002315 | ||||||
Person_evidence | WBPerson309 | |||||||
WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
Remark | Animals exhibited very short defecation cycles, which were significantly shorter at 25C. | Paper_evidence | WBPaper00002315 | |||||
Curator_confirmed | WBPerson712 | |||||||
ts, at 25C very short defecation cycle period, often with weak or missing motor program steps | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Complete | Person_evidence | WBPerson309 | |||||
Curator_confirmed | WBPerson48 | |||||||
Recessive | Paper_evidence | WBPaper00002315 | ||||||
Person_evidence | WBPerson309 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson309 | |||||
Curator_confirmed | WBPerson48 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002315 | ||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 25 | Person_evidence | WBPerson309 | ||||
Curator_confirmed | WBPerson48 | |||||||
20, 25 | Paper_evidence | WBPaper00002315 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000314 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000380 | Paper_evidence | WBPaper00002315 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The Exp step was activated less frequently, corresponding to shorter cycle periods. | Paper_evidence | WBPaper00002315 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00002315 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002315 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20, 25 | Paper_evidence | WBPaper00002315 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000651 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Con | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001502 | Person_evidence | WBPerson309 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Resistant to 0.4 mg/ml NaF | Person_evidence | WBPerson309 | |||||
Curator_confirmed | WBPerson48 | |||||||
Penetrance | Incomplete | Person_evidence | WBPerson309 | |||||
Curator_confirmed | WBPerson48 | |||||||
Phenotype_assay | Temperature | 25 | Person_evidence | WBPerson309 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001641 | Paper_evidence | WBPaper00002315 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | pBocs were noticibly weaker with the shortened cycle periods. | Paper_evidence | WBPaper00002315 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00002315 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002315 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20, 25 | Paper_evidence | WBPaper00002315 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001791 | Paper_evidence | WBPaper00002315 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited significantly different defecation cycles at 20C from that at 25C. | Paper_evidence | WBPaper00002315 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00002315 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002315 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20, 25 | Paper_evidence | WBPaper00002315 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001855 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | fluoride resistant | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003913 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000659 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | appears to feed normally | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00002315 | |||||||
Method | Substitution_allele |