WormBase Tree Display for Variation: WBVar00242198
expand all nodes | collapse all nodes | view schema
WBVar00242198 | Evidence | Person_evidence | WBPerson43879 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | s1733 | ||||||
Other_name | C29E6.1b.1:c.750T>A | |||||||
C29E6.1c.1:c.750T>A | ||||||||
C29E6.1a.1:c.750T>A | ||||||||
CE37323:p.Cys250Ter | ||||||||
CE40548:p.Cys250Ter | ||||||||
CE05332:p.Cys250Ter | ||||||||
HGVSg | CHROMOSOME_IV:g.11886885T>A | |||||||
Sequence_details | SMap | S_parent | Sequence | C29E6 | ||||
Flanking_sequences | catttatggactttatgacttcttcacttg | cggactgaaccaaaagaagccactgaattc | ||||||
Mapping_target | C29E6 | |||||||
Type_of_mutation | Substitution | t | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (11) | ||||||||
Laboratory | BC | |||||||
Person | WBPerson43879 | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00002827 | ||||||
Transcript | C29E6.1b.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | C29E6.1b.1:c.750T>A | |||||||
HGVSp | CE37323:p.Cys250Ter | |||||||
cDNA_position | 755 | |||||||
CDS_position | 750 | |||||||
Protein_position | 250 | |||||||
Exon_number | 5/11 | |||||||
Codon_change | tgT/tgA | |||||||
Amino_acid_change | C/* | |||||||
C29E6.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C29E6.1a.1:c.750T>A | |||||||
HGVSp | CE40548:p.Cys250Ter | |||||||
cDNA_position | 753 | |||||||
CDS_position | 750 | |||||||
Protein_position | 250 | |||||||
Exon_number | 5/12 | |||||||
Codon_change | tgT/tgA | |||||||
Amino_acid_change | C/* | |||||||
C29E6.1c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C29E6.1c.1:c.750T>A | |||||||
HGVSp | CE05332:p.Cys250Ter | |||||||
cDNA_position | 750 | |||||||
CDS_position | 750 | |||||||
Protein_position | 250 | |||||||
Exon_number | 4/10 | |||||||
Codon_change | tgT/tgA | |||||||
Amino_acid_change | C/* | |||||||
Isolation | Mutagen | EMS | ||||||
Forward_genetics | standard phenotypic screen | |||||||
Genetics | Interpolated_map_position | IV | 5.36499 | |||||
Mapping_data | In_pos_neg_data (18) | |||||||
Description | Phenotype | WBPhenotype:0000057 | Paper_evidence | WBPaper00001522 | ||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | early larval lethal, arrest stage is late L1 to early L2 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Early larval lethal arrest over sDf2 | Paper_evidence | WBPaper00001522 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000411 | Paper_evidence | WBPaper00049934 | ||||||
Curator_confirmed | WBPerson43879 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00049934 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Recessive | Paper_evidence | WBPaper00049934 | ||||||
Curator_confirmed | WBPerson43879 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00049934 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00049934 | ||||
Curator_confirmed | WBPerson43879 | |||||||
WBPhenotype:0000704 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | cystic excretory canals | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000858 | Paper_evidence | WBPaper00049934 | ||||||
Curator_confirmed | WBPerson43879 | |||||||
Remark | Figure 1. excretory dilation in duct cell | Paper_evidence | WBPaper00049934 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00049934 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Recessive | Paper_evidence | WBPaper00049934 | ||||||
Curator_confirmed | WBPerson43879 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00049934 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00049934 | ||||
Curator_confirmed | WBPerson43879 | |||||||
Reference | WBPaper00014024 | |||||||
WBPaper00001522 | ||||||||
WBPaper00030687 | ||||||||
WBPaper00049934 | ||||||||
Remark | alt_det = c to t mut_det = C(250)Opal | |||||||
[pad] reported as a c->t mutation but C(250) TGT can only transition to Amber_UGA Stop at the reported position. | ||||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00002827 Opal_UGA C(250) to stop | ||||||||
Method | Substitution_allele |