WormBase Tree Display for Variation: WBVar00241647

WBVar00241647 Evidence: Paper_evidence: WBPaper00025184
  Name: Public_name: ru18
    Other_name (12)
    HGVSg: CHROMOSOME_V:g.11903246_11904999delinsTCAACAACAAACGACAACACAACGACAA
  Sequence_details: SMap: S_parent: Sequence: K12G11
    Flanking_sequences: cactacaagttggcgcaatggattggcttt cttcaacgacatgctcgactcgaggaagag
    Mapping_target: K12G11
    Type_of_mutation: Insertion: tcaacaacaaacgacaacacaacgacaa Paper_evidence: WBPaper00025184
      Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00000327
    Laboratory: AZ
    Status: Live
  Affects: Gene: WBGene00004855
    Transcript: R31.1e.1 (11)
      R31.1a.1 (11)
      R31.1c.1 (11)
      R31.1b.1 (11)
      R31.1d.1 (11)
      R31.1f.1 (11)
  Genetics: Interpolated_map_position: V 3.53717
  Description: Phenotype: WBPhenotype:0000436 Paper_evidence: WBPaper00065564
        Curator_confirmed: WBPerson712
        Remark: "In all sma-1(ru18) null mutants examined, SPC-1::GFP failed to localize to apical membranes and was found only at basolateral membranes (Fig. 1E), resembling the pattern seen with UNC-70::GFP (Fig. 1B)." Paper_evidence: WBPaper00065564
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: UP4241 sma-1(ru18) V; spc-1(cas815 [SPC-1::GFP]) X Paper_evidence: WBPaper00065564
              Curator_confirmed: WBPerson712
      WBPhenotype:0000695 Paper_evidence: WBPaper00065564
        Curator_confirmed: WBPerson712
        Remark: "We observed a variety of vulva shape abnormalities in sma-1 mutants (e.g. Fig. 1F'), which may involve some of the above processes and will be described in a separate report." Paper_evidence: WBPaper00065564
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: UP4241 sma-1(ru18) V; spc-1(cas815 [SPC-1::GFP]) X Paper_evidence: WBPaper00065564
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000436 Paper_evidence: WBPaper00065564
        Curator_confirmed: WBPerson712
        Remark: "VAB-10a::GFP remained unchanged compared to wild type (Fig. 1D,F)." Paper_evidence: WBPaper00065564
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: UP4252 vab-10(cas602 [VAB-10a::GFP]) I; sma-1(ru18) V Paper_evidence: WBPaper00065564
              Curator_confirmed: WBPerson712
  Reference: WBPaper00012487
    WBPaper00012565
    WBPaper00061175
    WBPaper00065564
  Remark: Deletion is within CH1 region Paper_evidence: WBPaper00025184
    Variation stub/paper connection generated from the May 2021 NN VFP dataset.
    Created by WBPerson51134 from the NN_VFP_triage_pipeline
  Method: Deletion_and_insertion_allele