WormBase Tree Display for Variation: WBVar00241640
expand all nodes | collapse all nodes | view schema
WBVar00241640 | Evidence | Paper_evidence | WBPaper00013467 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | rt97 | |||||||
Other_name | W02B3.2.1:c.1061C>T | ||||||||
CE32946:p.Thr354Ile | |||||||||
HGVSg | CHROMOSOME_III:g.678061C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | W02B3 | |||||
Flanking_sequences | agtcacctaattgtttcaatttcagcggaa | ccacggctacatggcacccgaagtactggc | |||||||
Mapping_target | W02B3 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00008295 | ||||||||
Laboratory | HA | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001709 | |||||||
Transcript | W02B3.2.1 (12) | ||||||||
Interactor (13) | |||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00013467 | |||||
Genetics | Interpolated_map_position | III | -26.2886 | ||||||
Description | Phenotype | WBPhenotype:0000224 | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We next evaluated whether there was any change in 5-HT levels in the grk-2 mutants. To quantify the 5-HT levels in N2 and grk-2 mutant strains, we made lysates from purified 2nd day adult worms and determined 5-HT levels by HPLC with electrochemical (EC) detection. These studies revealed an ~40-fold reduction in 5-HT levels in the grk-2(lf) strains (Fig. 4A)." | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0042428 | PATO:0000460 | Paper_evidence | WBPaper00050796 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Molecule_affected | WBMol:00004929 | PATO:0001997 | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000249 | Paper_evidence | WBPaper00013467 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00013467 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Paper_evidence | WBPaper00013467 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00013467 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000303 | Paper_evidence | WBPaper00013467 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00013467 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Paper_evidence | WBPaper00013467 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00013467 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Affected_by | Molecule | WBMol:00002819 | Paper_evidence | WBPaper00013467 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000304 | Paper_evidence | WBPaper00013467 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00013467 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Paper_evidence | WBPaper00013467 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00013467 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Affected_by | Molecule | WBMol:00001063 | Paper_evidence | WBPaper00013467 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000412 | Paper_evidence | WBPaper00013467 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00013467 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Paper_evidence | WBPaper00013467 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00013467 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000545 | Paper_evidence | WBPaper00050796 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Although we anticipated that loss of GRK-2 would result in enhanced Gq signaling and constitutive egg laying, both grk-2(lf) alleles were egg laying-defective as each mutant retained ~35 eggs compared with 13-14 eggs in the wild-type N2 worms (Figs. 1B and C)... Expression of GRK-2 in HSNs fully rescued the egg laying defect in grk-2(rt97) ... (Fig. 2C)." | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00024880 | ||||||||
WBTransgene00024879 | |||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00050796 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0018991 | PATO:0000460 | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000630 | Paper_evidence | WBPaper00013467 | |||||||
WBPaper00035961 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Penetrance | Complete | Paper_evidence | WBPaper00013467 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Paper_evidence | WBPaper00013467 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00013467 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Affected_by | Molecule | WBMol:00003904 | Paper_evidence | WBPaper00013467 | |||||
WBPaper00035961 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
WBPhenotype:0001483 | Paper_evidence | WBPaper00050796 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Although there was no difference in the brood size between N2 and grk-2 mutants (Fig. 1D), a significant number of the laid eggs were late stage in the grk-2 loss-of-function strains (Fig. 1E)." | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002357 | Paper_evidence | WBPaper00050796 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To quantify 5-HIAA levels, we also used HPLC-EC analysis to measure 5-HIAA in lysates from N2 and grk-2 mutant strains. These studies revealed a ~250-fold increase in 5-HIAA levels in the grk-2 mutants compared with N2 (Fig. 4A). Thus, there appears to be a significant increase in 5-HT metabolism in the grk-2 mutant strains." | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0042428 | PATO:0000460 | Paper_evidence | WBPaper00050796 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Molecule_affected | WBMol:00005472 | PATO:0002270 | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000274 | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Because we did not observe a significant number of unfertilized eggs or dead embryos in the grk-2 mutant strains, this suggests that the sperm capacity and development of embryos are normal in these strains." | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000357 | Paper_evidence | WBPaper00050796 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Because we did not observe a significant number of unfertilized eggs or dead embryos in the grk-2 mutant strains, this suggests that the sperm capacity and development of embryos are normal in these strains." | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00050796 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To determine whether there were any changes in 5-HT synthesis, we measured tph-1 expression in N2 and grk-2 mutants by generating transgenic strains expressing GFP using the tph-1 promoter (tph-1::GFP). No differences in tph-1::GFP expression were observed in the N2 and grk-2 mutant strains as assessed by fluorescence (data not shown). We also evaluated TPH-1 using a mammalian Tph1 antibody and found that TPH-1 protein levels are similar in wild type and grk-2 mutants at several developmental stages (Fig. 4B)." | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000673 | Paper_evidence | WBPaper00050796 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Although there was no difference in the brood size between N2 and grk-2 mutants (Fig. 1D), a significant number of the laid eggs were late stage in the grk-2 loss-of-function strains (Fig. 1E)." | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0004026 | Paper_evidence | WBPaper00013467 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Disease_info | Modifies_disease | DOID:12377 | |||||||
Modifies_disease_in_annotation | WBDOannot00000887 | ||||||||
Reference | WBPaper00025902 | ||||||||
WBPaper00013467 | |||||||||
WBPaper00035961 | |||||||||
WBPaper00018915 | |||||||||
WBPaper00017988 | |||||||||
WBPaper00050796 | |||||||||
WBPaper00066032 | |||||||||
Method | Substitution_allele |