WormBase Tree Display for Variation: WBVar00241590
expand all nodes | collapse all nodes | view schema
WBVar00241590 | Evidence | Paper_evidence | WBPaper00005833 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | rh252 | |||||||
Other_name | F35H8.5a.1:c.152_238+165del | ||||||||
HGVSg | CHROMOSOME_II:g.9578380_9578631del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F35H8 | |||||
Flanking_sequences | aaacaaatttaattatcaattatctgccac | gccgaaaaagtttagcatgaaactagattt | |||||||
Mapping_target | F35H8 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00028852 | ||||||||
Laboratory | NJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001368 | |||||||
Transcript | F35H8.5a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F35H8.5a.1:c.152_238+165del | ||||||||
cDNA_position | 489-? | ||||||||
CDS_position | 152-? | ||||||||
Protein_position | 51-? | ||||||||
Intron_number | 3/8 | ||||||||
Exon_number | 3/9 | ||||||||
Genetics | Interpolated_map_position | II | 1.60927 | ||||||
Mapping_data | In_multi_point | 3292 | |||||||
Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00006029 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ric phenotype is not rescued by an elevation in ambient temperature (data not shown). | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00006029 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were monitored for paralysis over time in the presence of 1mM alicarb at 15C. | Paper_evidence | WBPaper00006029 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 15 | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000704 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | excretory canal defect. Canal is invariably short with multiple cysts of varying size clustered along length, especially at the tips. Visible only by Nomarski microscopy. Animal is somewhat pale | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001261 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | animal is somewhat pale | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000205 | Paper_evidence | WBPaper00006029 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | data not shown. | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000616 | Paper_evidence | WBPaper00006029 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | synaptic vesicles in the cholinergic SAB neurons cluster normally (data not shown). | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005396 | PATO:0000460 | Paper_evidence | WBPaper00006029 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00006029 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000816 | Paper_evidence | WBPaper00006029 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | As visualized by cell-specific gfp markers; data not shown. | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006840 | PATO:0000460 | Paper_evidence | WBPaper00006029 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00006029 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | As visualized by cell-specific gfp markers; data not shown. | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006840 | PATO:0000460 | Paper_evidence | WBPaper00006029 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00018636 | ||||||||
WBPaper00006029 | |||||||||
WBPaper00012423 | |||||||||
WBPaper00015411 | |||||||||
WBPaper00015113 | |||||||||
WBPaper00022868 | |||||||||
WBPaper00005833 | |||||||||
WBPaper00015612 | |||||||||
WBPaper00023211 | |||||||||
WBPaper00017865 | |||||||||
Method | Deletion_allele |