WormBase Tree Display for Variation: WBVar00241556
expand all nodes | collapse all nodes | view schema
WBVar00241556 | Evidence | Paper_evidence | WBPaper00032247 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | rh148 | |||||||
Other_name | ZC504.4b.1:c.503T>A | ||||||||
CE25673:p.Val168Glu | |||||||||
ZC504.4c.1:c.503T>A | |||||||||
ZC504.4d.1:c.503T>A | |||||||||
ZC504.4a.1:c.503T>A | |||||||||
CE32767:p.Val168Glu | |||||||||
CE28273:p.Val168Glu | |||||||||
CE25672:p.Val168Glu | |||||||||
HGVSg | CHROMOSOME_X:g.10427352A>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZC504 | |||||
Flanking_sequences | ttgtcaagttgtgcagatactccgaaatct | ccagcttcacctcagcactgtccgtaagaa | |||||||
Mapping_target | ZC504 | ||||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00024147 | ||||||||
WBStrain00028845 | |||||||||
Laboratory | NJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003247 | |||||||
Transcript | ZC504.4d.1 (12) | ||||||||
ZC504.4a.1 (12) | |||||||||
ZC504.4c.1 (12) | |||||||||
ZC504.4b.1 (12) | |||||||||
Genetics | Interpolated_map_position | X | 2.19101 | ||||||
Mapping_data | In_multi_point | 3293 | |||||||
3294 | |||||||||
3295 | |||||||||
3296 | |||||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000273 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit reduced thrashing compared to wild type animals. | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000469 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | QL migration resembles QR. Pleiotropic defects in hypodermis | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000701 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Pleiotropic defects in hypodermis | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005733 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000571 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No gaps in the pattern of fluorescence of juIs1[Punc-25::SNB-1::GFP] labeled synaptic vesicles were observed in GABAergic D-type motor neurons. | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005190 | PATO:0000460 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:1826 | |||||||
Models_disease_in_annotation | WBDOannot00000555 | ||||||||
Reference | WBPaper00015437 | ||||||||
WBPaper00022857 | |||||||||
WBPaper00014322 | |||||||||
WBPaper00035198 | |||||||||
WBPaper00032247 | |||||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||||
Method | Substitution_allele |