WormBase Tree Display for Variation: WBVar00241554
expand all nodes | collapse all nodes | view schema
| WBVar00241554 | Evidence | Paper_evidence | WBPaper00037788 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name (3) | |||||||||
| Sequence_details | SMap | S_parent | Sequence | C52E12 | |||||
| Flanking_sequences | ttttatcatatccaggtatttggacatttc | aaccaaaaagtgaacagttcaatttcgaaa | |||||||
| Mapping_target | C52E12 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00037788 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00028847 | ||||||||
| Laboratory | NJ | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006831 | |||||||
| Transcript (3) | |||||||||
| Genetics | Interpolated_map_position | II | 0.244357 | ||||||
| Mapping_data | In_2_point | 6169 | |||||||
| In_multi_point | 2424 | ||||||||
| Description | Phenotype | WBPhenotype:0000032 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | sublethal | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000517 | Paper_evidence | WBPaper00001424 | |||||||
| Curator_confirmed | WBPerson233 | ||||||||
| Remark | several unc-104 alleles showed deficits in locomotion, feeding rate and defecation that varied in proportion to changes in synaptic vesicle transport within axons | Paper_evidence | WBPaper00001424 | ||||||
| Curator_confirmed | WBPerson233 | ||||||||
| WBPhenotype:0000672 | Paper_evidence | WBPaper00001424 | |||||||
| Curator_confirmed | WBPerson233 | ||||||||
| Remark | Figures 3 and 4 show changes in localization of synaptic vesicles in unc-104 alleles, with most vesicles concentrated in the neuron soma, while failing to reach chemical synaptic locales in the nerve ring | Paper_evidence | WBPaper00001424 | ||||||
| Curator_confirmed | WBPerson233 | ||||||||
| Phenotype_not_observed | WBPhenotype:0001661 | Paper_evidence | WBPaper00039901 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Mutants of more severe alleles of unc-104 also did not cause 2AWC-ON. | Paper_evidence | WBPaper00039901 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00039901 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00039901 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | [str-2p::GFP] | Paper_evidence | WBPaper00039901 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00014849 | ||||||||
| WBPaper00039901 | |||||||||
| WBPaper00001424 | |||||||||
| WBPaper00014401 | |||||||||
| WBPaper00037788 | |||||||||
| Method | Substitution_allele |
