WormBase Tree Display for Variation: WBVar00241554
expand all nodes | collapse all nodes | view schema
WBVar00241554 | Evidence | Paper_evidence | WBPaper00037788 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | C52E12 | |||||
Flanking_sequences | ttttatcatatccaggtatttggacatttc | aaccaaaaagtgaacagttcaatttcgaaa | |||||||
Mapping_target | C52E12 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00037788 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00028847 | ||||||||
Laboratory | NJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006831 | |||||||
Transcript | C52E12.2a.2 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C52E12.2a.2:c.2989C>T | ||||||||
HGVSp | CE48050:p.Gln997Ter | ||||||||
cDNA_position | 2991 | ||||||||
CDS_position | 2989 | ||||||||
Protein_position | 997 | ||||||||
Exon_number | 18/24 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
C52E12.2b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C52E12.2b.1:c.3130C>T | ||||||||
HGVSp | CE47855:p.Gln1044Ter | ||||||||
cDNA_position | 3330 | ||||||||
CDS_position | 3130 | ||||||||
Protein_position | 1044 | ||||||||
Exon_number | 19/25 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
C52E12.2a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C52E12.2a.1:c.2989C>T | ||||||||
HGVSp | CE48050:p.Gln997Ter | ||||||||
cDNA_position | 3125 | ||||||||
CDS_position | 2989 | ||||||||
Protein_position | 997 | ||||||||
Exon_number | 18/24 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Genetics | Interpolated_map_position | II | 0.244357 | ||||||
Mapping_data | In_2_point | 6169 | |||||||
In_multi_point | 2424 | ||||||||
Description | Phenotype | WBPhenotype:0000032 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | sublethal | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000517 | Paper_evidence | WBPaper00001424 | |||||||
Curator_confirmed | WBPerson233 | ||||||||
Remark | several unc-104 alleles showed deficits in locomotion, feeding rate and defecation that varied in proportion to changes in synaptic vesicle transport within axons | Paper_evidence | WBPaper00001424 | ||||||
Curator_confirmed | WBPerson233 | ||||||||
WBPhenotype:0000672 | Paper_evidence | WBPaper00001424 | |||||||
Curator_confirmed | WBPerson233 | ||||||||
Remark | Figures 3 and 4 show changes in localization of synaptic vesicles in unc-104 alleles, with most vesicles concentrated in the neuron soma, while failing to reach chemical synaptic locales in the nerve ring | Paper_evidence | WBPaper00001424 | ||||||
Curator_confirmed | WBPerson233 | ||||||||
Phenotype_not_observed | WBPhenotype:0001661 | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants of more severe alleles of unc-104 also did not cause 2AWC-ON. | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype (2) | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00039901 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | [str-2p::GFP] | Paper_evidence | WBPaper00039901 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00014849 | ||||||||
WBPaper00039901 | |||||||||
WBPaper00001424 | |||||||||
WBPaper00014401 | |||||||||
WBPaper00037788 | |||||||||
Method | Substitution_allele |