WormBase Tree Display for Variation: WBVar00241539
expand all nodes | collapse all nodes | view schema
WBVar00241539 | Evidence | Paper_evidence | WBPaper00028396 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | rh94 | |||||
Other_name | T05C12.6b.1:c.1019+1G>T | ||||||
T05C12.6c.1:c.897-46G>T | |||||||
T05C12.6a.1:c.1019+1G>T | |||||||
HGVSg | CHROMOSOME_II:g.8183734C>A | ||||||
Sequence_details | SMap | S_parent | Sequence | T05C12 | |||
Flanking_sequences | cgacgttggagtttgggtagaaaccgctgt | taagggtacctcgcaagatttattttctta | |||||
Mapping_target | T05C12 | ||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00028396 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00034588 | ||||||
Laboratory | NJ | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003241 | |||||
Transcript | T05C12.6b.1 | VEP_consequence | splice_donor_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | T05C12.6b.1:c.1019+1G>T | ||||||
Intron_number | 7/10 | ||||||
T05C12.6a.1 | VEP_consequence | splice_donor_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | T05C12.6a.1:c.1019+1G>T | ||||||
Intron_number | 7/10 | ||||||
T05C12.6c.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | ||||||
HGVSc | T05C12.6c.1:c.897-46G>T | ||||||
Intron_number | 6/9 | ||||||
Genetics | Interpolated_map_position | II | 0.749081 | ||||
Description | Phenotype (14) | ||||||
Reference | WBPaper00028396 | ||||||
Remark | rh94 abrogates a splice site, resulting in read-through into intron 6 where the first codon is a stop codon. | Paper_evidence | WBPaper00028396 | ||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003241 Splice_site | |||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003241 Coding_exon | Paper_evidence | WBPaper00028396 | |||||
Method | Substitution_allele |