WormBase Tree Display for Variation: WBVar00241518
expand all nodes | collapse all nodes | view schema
WBVar00241518 | Evidence | Paper_evidence | WBPaper00005054 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | rh50 | |||||||
Other_name | CE30451:p.Asp355Asn | ||||||||
T13C5.1b.1:c.1063G>A | |||||||||
CE53632:p.Asp334Asn | |||||||||
T13C5.1a.1:c.1108G>A | |||||||||
CE27206:p.Asp370Asn | |||||||||
T13C5.1c.1:c.1000G>A | |||||||||
HGVSg | CHROMOSOME_X:g.6199894G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T13C5 | |||||
Flanking_sequences | agagacctttcaatcatcctaacatgtgga | atatgtggacaggaggtatggaaactactg | |||||||
Mapping_target | T13C5 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004904 | ||||||||
WBStrain00004909 | |||||||||
WBStrain00008412 | |||||||||
WBStrain00033328 | |||||||||
WBStrain00047368 | |||||||||
Laboratory | NJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000905 | |||||||
Transcript | T13C5.1c.1 (12) | ||||||||
T13C5.1b.1 (12) | |||||||||
T13C5.1a.1 (12) | |||||||||
Interactor | WBInteraction000532940 | ||||||||
WBInteraction000532941 | |||||||||
WBInteraction000532959 | |||||||||
Genetics | Interpolated_map_position | X | -3.46105 | ||||||
Mapping_data | In_multi_point | 1320 | |||||||
Description | Phenotype | WBPhenotype:0000013 | Paper_evidence | WBPaper00040979 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Partial reduction of daf-9 function results in animals that bypass the dauer stage yet exhibit abnormal gonadal morphogenesis and migration (Mig; WBPhenotype:0000594) and occasionally aberrant cuticle shedding (Cut; WBPhenotype: 0000077) defects (Figure 2A) [18,19]." | Paper_evidence | WBPaper00040979 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000301 | Paper_evidence | WBPaper00024451 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | distal tip cells fail to reflex | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Table 1 | Paper_evidence | WBPaper00024451 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | High | 89 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00024451 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO:0008406 | PATO:0000460 | Paper_evidence | WBPaper00024451 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000690 | Paper_evidence | WBPaper00040979 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "... the weak loss-of-function allele daf-9(rh50) does not result in Daf-c phenotypes, but in highly penetrant Mig defects (95% +/- 3%) [18]. In these animals, only 10 nM of DA was required to rescue over 90% of the Mig phenotypes (Figure 2C), revealing a 5-fold decrease in the amount of exogenous DA required to promote normal development compared to the stronger daf-9 mutants (dh6, e1406, and m540; Figure 2S). Thus, daf-9(rh50) animals produce sufficient amounts of DA to bypass dauer development but require additional DA to develop into normal adults, consistent with our finding that different levels of DA are required for the two processes." | Paper_evidence | WBPaper00040979 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001375 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | fails to express unc-5::lacZ | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001739 | Paper_evidence | WBPaper00045724 | |||||||
Curator_confirmed | WBPerson4671 | ||||||||
Remark | unable to respond to dietary restriction | Paper_evidence | WBPaper00045724 | ||||||
Curator_confirmed | WBPerson4671 | ||||||||
WBPhenotype:0001980 | Paper_evidence | WBPaper00045724 | |||||||
Curator_confirmed | WBPerson4671 | ||||||||
Remark | Large amount of germ cells in the transition zone upon dietary restriction | Paper_evidence | WBPaper00045724 | ||||||
Curator_confirmed | WBPerson4671 | ||||||||
Phenotype_not_observed | WBPhenotype:0000012 | Paper_evidence | WBPaper00040979 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "... the weak loss-of-function allele daf-9(rh50) does not result in Daf-c phenotypes, but in highly penetrant Mig defects (95% +/- 3%) [18]. In these animals, only 10 nM of DA was required to rescue over 90% of the Mig phenotypes (Figure 2C), revealing a 5-fold decrease in the amount of exogenous DA required to promote normal development compared to the stronger daf-9 mutants (dh6, e1406, and m540; Figure 2S). Thus, daf-9(rh50) animals produce sufficient amounts of DA to bypass dauer development but require additional DA to develop into normal adults, consistent with our finding that different levels of DA are required for the two processes." | Paper_evidence | WBPaper00040979 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000013 | Paper_evidence | WBPaper00024451 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00024451 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000032 | PATO:0000460 | Paper_evidence | WBPaper00024451 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0040024 | PATO:0000460 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000033 | Paper_evidence | WBPaper00024451 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | daf-9(rh50) mutants do not exhibit L3 seam cell division timing defects | Paper_evidence | WBPaper00024451 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00024451 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0048505 | PATO:0000460 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000280 | Paper_evidence | WBPaper00024451 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | daf-9(rh50) mutants exhibit wild type adult seam cells and alae (Table 1) | Paper_evidence | WBPaper00024451 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00024451 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0048505 | PATO:0000460 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO:0042335 | PATO:0000460 | Paper_evidence | WBPaper00024451 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00024451 | ||||||||
WBPaper00040979 | |||||||||
WBPaper00005054 | |||||||||
WBPaper00017899 | |||||||||
WBPaper00018241 | |||||||||
WBPaper00045724 | |||||||||
Method | Substitution_allele |