WormBase Tree Display for Variation: WBVar00241516
expand all nodes | collapse all nodes | view schema
WBVar00241516 | Name | Public_name | rh43 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE47855:p.Gly96Glu | ||||||||
C52E12.2a.2:c.287G>A | |||||||||
CE48050:p.Gly96Glu | |||||||||
C52E12.2b.1:c.287G>A | |||||||||
C52E12.2a.1:c.287G>A | |||||||||
HGVSg | CHROMOSOME_II:g.6996791G>A | ||||||||
Sequence_details (5) | |||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00028844 | ||||||||
Laboratory | NJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006831 | |||||||
Transcript | C52E12.2a.2 (12) | ||||||||
C52E12.2b.1 (12) | |||||||||
C52E12.2a.1 (12) | |||||||||
Interactor | WBInteraction000505162 | ||||||||
WBInteraction000555715 | |||||||||
WBInteraction000555716 | |||||||||
Genetics | Interpolated_map_position | II | 0.209091 | ||||||
Description | Phenotype | WBPhenotype:0000180 | Paper_evidence | WBPaper00006029 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 30/58 adult animals showed defects as visualized by unc-47::GFP. | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004822 | PATO:0000460 | Paper_evidence | WBPaper00006029 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006029 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000517 | Paper_evidence | WBPaper00001424 | |||||||
Curator_confirmed | WBPerson233 | ||||||||
Remark | several unc-104 alleles showed deficits in locomotion, feeding rate and defecation that varied in proportion to changes in synaptic vesicle transport within axons | Paper_evidence | WBPaper00001424 | ||||||
Curator_confirmed | WBPerson233 | ||||||||
WBPhenotype:0000565 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | severe | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00040335 | |||||||
Curator_confirmed | WBPerson7190 | ||||||||
WBPhenotype:0000672 | Paper_evidence | WBPaper00001424 | |||||||
Curator_confirmed | WBPerson233 | ||||||||
Remark | Figures 3 and 4 show changes in localization of synaptic vesicles in unc-104 alleles, with most vesicles concentrated in the neuron soma, while failing to reach chemical synaptic locales in the nerve ring | Paper_evidence | WBPaper00001424 | ||||||
Curator_confirmed | WBPerson233 | ||||||||
WBPhenotype:0002490 | Paper_evidence | WBPaper00006029 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 30/58 adult animals showed defects as visualized by unc-47::GFP. | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004822 | PATO:0000460 | Paper_evidence | WBPaper00006029 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006029 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed (2) | |||||||||
Reference (12) | |||||||||
Remark | In addition to the lesion described, the rh43 mutation also gives rise to a G314E mutation with flanks tgacgtggcttctgagagaaaatctgggag aaattcgaaaactgcgatgctcgcggcatt | Paper_evidence | WBPaper00037788 | ||||||
Method | Substitution_allele |