WormBase Tree Display for Variation: WBVar00241208
expand all nodes | collapse all nodes | view schema
WBVar00241208 | Evidence | Paper_evidence | WBPaper00032934 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | qa1809 | |||||
Other_name | CE31986:p.Ser156HisfsTer11 | ||||||
T06C12.10.1:c.463_1123del | |||||||
HGVSg | CHROMOSOME_V:g.15887366_15888273del | ||||||
Sequence_details | SMap | S_parent | Sequence | T06C12 | |||
Flanking_sequences | ttcggaagaagatgaagcaattgaagttgta | agacatttggtttgcacttgttttattggat | |||||
Mapping_target | T06C12 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | XA | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00011517 | |||||
Transcript | T06C12.10.1 (11) | ||||||
Interactor | WBInteraction000050617 | ||||||
WBInteraction000050618 | |||||||
WBInteraction000050619 | |||||||
WBInteraction000050620 | |||||||
WBInteraction000050621 | |||||||
Genetics | Interpolated_map_position | V | 9.09857 | ||||
Description | Phenotype_not_observed | WBPhenotype:0000383 | Paper_evidence | WBPaper00032934 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Levels of GlcCer derivatives in the putative null alleles cgt-1(qa1809) and cgt-3(tm504) were not affected in comparison with those of wild-type animals | Paper_evidence | WBPaper00032934 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00032934 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000886 | Paper_evidence | WBPaper00032934 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | All single CGT mutants showed no observable phenotype | Paper_evidence | WBPaper00032934 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00032934 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00032934 | ||||||
Method | Deletion_allele |