WormBase Tree Display for Variation: WBVar00241172
expand all nodes | collapse all nodes | view schema
WBVar00241172 | Evidence | Paper_evidence | WBPaper00026963 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | q686 | |||||||
Other_name | CE38824:p.Pro289Ser | ||||||||
F44C4.4a.1:c.865C>T | |||||||||
F44C4.4b.1:c.865C>T | |||||||||
CE38823:p.Pro289Ser | |||||||||
HGVSg | CHROMOSOME_V:g.6610195G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F44C4 | |||||
Flanking_sequences | gcgttcaacatgaattcagaatattctctt | caactgttgaaacgatgcattcatttctcg | |||||||
Mapping_target | F44C4 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00026963 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022620 | ||||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002148 | |||||||
Transcript | F44C4.4b.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | F44C4.4b.1:c.865C>T | ||||||||
HGVSp | CE38824:p.Pro289Ser | ||||||||
cDNA_position | 865 | ||||||||
CDS_position | 865 | ||||||||
Protein_position | 289 | ||||||||
Exon_number | 3/15 | ||||||||
Codon_change | Cca/Tca | ||||||||
Amino_acid_change | P/S | ||||||||
F44C4.4a.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | F44C4.4a.1:c.865C>T | ||||||||
HGVSp | CE38823:p.Pro289Ser | ||||||||
cDNA_position | 865 | ||||||||
CDS_position | 865 | ||||||||
Protein_position | 289 | ||||||||
Exon_number | 3/15 | ||||||||
Codon_change | Cca/Tca | ||||||||
Amino_acid_change | P/S | ||||||||
Interactor | WBInteraction000538593 | ||||||||
Genetics | Interpolated_map_position | V | 0.11151 | ||||||
Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "For gon-14, most animals homozygous for the strong loss-of-function allele gon-14(q12) arrested at midlarval development (L2 or L3), but animals homozygous for the temperature-sensitive allele, gon-14(q686), developed to adulthood more slowly than wild type (see materials and methods)." | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0040007 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000324 | Paper_evidence | WBPaper00006440 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In addition, whereas sys-3 mutant adults attained a normal size, gon-14, gon-15, and gon-16 adults were typically about one-half to two-thirds the length of wild-type adults." | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0040007 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000893 | Paper_evidence | WBPaper00006440 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 7 | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 28 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001357 | Paper_evidence | WBPaper00006440 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In addition to the Glp phenotype, gon-14, gon-15, and gon-16 mutant males often had disorganized gonads with elongation defects..." | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006794 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0008406 | PATO:0000460 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001586 | Paper_evidence | WBPaper00006440 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Analysis of AC formation gave an unexpected result. Whereas most sys-1 and pop-1 mutants made two or more ACs, as described previously (Miskowski et al. 2001; Siegfried and Kimble 2002), most sys-3, gon-15, gon-16, and many gon-14 mutants had only one AC, although a few had more (Table 6)." | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 15 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004522 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0008406 | PATO:0000460 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | syIs50 [cdh-3::GFP] | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001962 | Paper_evidence | WBPaper00006440 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "As expected, sys-3, gon-14, gon-15, and gon-16 mutants failed to make DTCs (Table 5; Figure 4, B and E), but DTC loss was not fully penetrant and was temperature sensitive (Table 5)." | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | High | 97 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006863 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0008406 | PATO:0000460 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | qIs57 [lag-2::GFP] | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002136 | Paper_evidence | WBPaper00006440 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Analysis of AC formation gave an unexpected result. Whereas most sys-1 and pop-1 mutants made two or more ACs, as described previously (Miskowski et al. 2001; Siegfried and Kimble 2002), most sys-3, gon-15, gon-16, and many gon-14 mutants had only one AC, although a few had more (Table 6)." | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 45 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004522 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0008406 | PATO:0000460 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | syIs50 [cdh-3::GFP] | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002188 | Paper_evidence | WBPaper00006440 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "... gon-14(q686) mutant males occasionally produced a vulva (6%, n = 47, 25C." | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | 6 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0008406 | PATO:0000460 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002211 | Paper_evidence | WBPaper00006440 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "The sys-1, sys-3, gon-15, and gon-16 mutants had little effect on phasmid socket cells, but the gon-14(q686) temperature-sensitive mutant raised at restrictive temperature sometimes failed to take up dye into the phasmids (Table 5)." | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 16 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005425 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0007423 | PATO:0000460 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000070 | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "No obvious male tail defects were observed in gon-14(q686) mutants raised at 25C or in sys-3 mutant males raised at 20C." | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005741 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001585 | Paper_evidence | WBPaper00006440 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In contrast to the Wnt/MAPK mutants, which eliminate POP-1 asymmetry, sys-1, sys-3, gon-14, gon-15, and gon-16 mutants did not affect POP-1 asymmetry (Figure 5)." | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001962 | Paper_evidence | WBPaper00006440 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 5 | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006863 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0008406 | PATO:0000460 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | qIs57 [lag-2::GFP] | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00006440 | ||||||||
WBPaper00026963 | |||||||||
Method | Substitution_allele |