WormBase Tree Display for Variation: WBVar00241137
expand all nodes | collapse all nodes | view schema
WBVar00241137 | Evidence | Paper_evidence | WBPaper00005437 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | q497 | |||||||
Other_name (11) | |||||||||
HGVSg | CHROMOSOME_I:g.6382986_6382987delinsAA | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZC308 | |||||
Flanking_sequences | ttttcctgtttcagctcagcgagaaaattt | gattatcacaacaaggtgtctcaaactgac | |||||||
Mapping_target | ZC308 | ||||||||
Type_of_mutation | Substitution | gg | rr | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (16) | |||||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001596 | |||||||
Transcript | ZC308.1e.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC308.1e.1:c.863_864delinsAA | ||||||||
HGVSp | CE50283:p.Trp288Ter | ||||||||
cDNA_position | 863-864 | ||||||||
CDS_position | 863-864 | ||||||||
Protein_position | 288 | ||||||||
Exon_number | 7/13 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
ZC308.1a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC308.1a.1:c.1661_1662delinsAA | ||||||||
HGVSp | CE32766:p.Trp554Ter | ||||||||
cDNA_position | 1877-1878 | ||||||||
CDS_position | 1661-1662 | ||||||||
Protein_position | 554 | ||||||||
Exon_number | 15/22 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
ZC308.1a.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC308.1a.2:c.1661_1662delinsAA | ||||||||
HGVSp | CE32766:p.Trp554Ter | ||||||||
cDNA_position | 1756-1757 | ||||||||
CDS_position | 1661-1662 | ||||||||
Protein_position | 554 | ||||||||
Exon_number | 14/21 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
ZC308.1f.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC308.1f.1:c.584_585delinsAA | ||||||||
HGVSp | CE50157:p.Trp195Ter | ||||||||
cDNA_position | 584-585 | ||||||||
CDS_position | 584-585 | ||||||||
Protein_position | 195 | ||||||||
Exon_number | 5/11 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
ZC308.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC308.1b.1:c.935_936delinsAA | ||||||||
HGVSp | CE15159:p.Trp312Ter | ||||||||
cDNA_position | 994-995 | ||||||||
CDS_position | 935-936 | ||||||||
Protein_position | 312 | ||||||||
Exon_number | 4/11 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
ZC308.1c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC308.1c.1:c.1430_1431delinsAA | ||||||||
HGVSp | CE33255:p.Trp477Ter | ||||||||
cDNA_position | 1467-1468 | ||||||||
CDS_position | 1430-1431 | ||||||||
Protein_position | 477 | ||||||||
Exon_number | 7/14 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000501293 | ||||||||
WBInteraction000501965 | |||||||||
WBInteraction000502155 | |||||||||
WBInteraction000502651 | |||||||||
WBInteraction000519048 | |||||||||
WBInteraction000542231 | |||||||||
WBInteraction000542232 | |||||||||
WBInteraction000542233 | |||||||||
WBInteraction000542234 | |||||||||
WBInteraction000569087 | |||||||||
Genetics | Interpolated_map_position | I | 1.06701 | ||||||
Description | Phenotype | WBPhenotype:0000670 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Spermatogenesis defective in males. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000823 | Paper_evidence | WBPaper00032182 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals displayed germ cell over-proliferation. | Paper_evidence | WBPaper00032182 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00032182 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001797 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | germ cells enter meiosis, fail in pachytene, make enlarged oocyte-like cells. Spermatogenesis also defective in males. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (12) | |||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001596 Amber_UAG_or_Opal_UGA W(554) to stop | Paper_evidence | WBPaper00005437 | ||||||
Method | Substitution_allele |