WormBase Tree Display for Variation: WBVar00241106
expand all nodes | collapse all nodes | view schema
WBVar00241106 | Evidence | Paper_evidence | WBPaper00002046 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | q411 | |||||||
Other_name | CE22970:p.Gln79Ter | ||||||||
Y73C8B.4.1:c.235C>T | |||||||||
HGVSg | CHROMOSOME_V:g.3188584C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y73C8B | |||||
Flanking_sequences | ccggtcttcaacttttccattcaacttgtg | agccgttcactggtcagccgctcggtgatc | |||||||
Mapping_target | Y73C8B | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002046 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022544 | ||||||||
WBStrain00022574 | |||||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002246 | |||||||
Transcript | Y73C8B.4.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y73C8B.4.1:c.235C>T | ||||||||
HGVSp | CE22970:p.Gln79Ter | ||||||||
cDNA_position | 242 | ||||||||
CDS_position | 235 | ||||||||
Protein_position | 79 | ||||||||
Exon_number | 2/5 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00002046 | |||||
Genetics | Interpolated_map_position | V | -12.7119 | ||||||
Description | Phenotype | WBPhenotype:0000094 | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Anus is absent. A protrusion is present at the normal location of the anal opening | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 98 percent of L1 lethals lack both the excretory cell and rectum/anus. 2 percent of L1 lethals lack either the excretory cell and rectum/anus | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype (2) | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005364 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000117 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype (2) | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000621 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | There is no detectable excretory cell or excretory duct and a small protrusion is present at the normal location of the excretory pore | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 98 percent of L1 lethals lack both the excretory cell and rectum/anus. 2 percent of L1 lethals lack either the excretory cell and rectum/anus | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype (2) | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005812 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005777 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001098 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The rectum is undetectable | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 98 percent of L1 lethals lack both the excretory cell and rectum/anus. 2 percent of L1 lethals lack either the excretory cell and rectum/anus | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype (2) | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005773 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001099 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 4 percent of L1 lethals have a twisted nose | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype (2) | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00001423 | ||||||||
WBPaper00017793 | |||||||||
Method | Substitution_allele |