WormBase Tree Display for Variation: WBVar00241046
expand all nodes | collapse all nodes | view schema
WBVar00241046 | Evidence | Paper_evidence | WBPaper00005045 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | q248 | |||||
Other_name | CE27480:p.Lys238Asn | ||||||
Y54E10A.4a.1:c.72G>T | |||||||
Y54E10A.4b.1:c.714G>T | |||||||
Y54E10A.4a.2:c.72G>T | |||||||
CE27479:p.Lys24Asn | |||||||
HGVSg | CHROMOSOME_I:g.3213189G>T | ||||||
Sequence_details | SMap | S_parent | Sequence | Y54E10A | |||
Flanking_sequences | tggaacggttttcgtcgattggccagtgaa | cagaagccgaattgtaggatttttattttt | |||||
Mapping_target | Y54E10A | ||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00005045 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | JK | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001481 | |||||
Transcript | Y54E10A.4a.1 (12) | ||||||
Y54E10A.4b.1 (12) | |||||||
Y54E10A.4a.2 (12) | |||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00005045 | |||
Genetics | Interpolated_map_position | I | -4.47298 | ||||
Reference | WBPaper00005045 | ||||||
Remark | This substitution is coupled with another substitution [g/a] downstream causing a missense mutation [G343 to R] | Paper_evidence | WBPaper00005045 | ||||
Method | Substitution_allele |