WormBase Tree Display for Variation: WBVar00241038
expand all nodes | collapse all nodes | view schema
WBVar00241038 | Evidence | Paper_evidence | WBPaper00001677 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | q231 | |||||||
Other_name | CE00237:p.Gly1057Glu | ||||||||
F02A9.6.1:c.3170G>A | |||||||||
HGVSg | CHROMOSOME_III:g.9098563G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F02A9 | |||||
Flanking_sequences | tggagatggcagagcttcttctttcaaaag | agcaaaacttgattacgatggtgctgctag | |||||||
Mapping_target | F02A9 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001677 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007142 | ||||||||
WBStrain00022514 | |||||||||
WBStrain00022527 | |||||||||
WBStrain00022529 | |||||||||
WBStrain00022531 | |||||||||
WBStrain00022532 | |||||||||
WBStrain00022542 | |||||||||
WBStrain00027164 | |||||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | III | 0.16398 | ||||||
Mapping_data | In_multi_point | 1734 | |||||||
2765 | |||||||||
2766 | |||||||||
Description | Phenotype (7) | ||||||||
Phenotype_not_observed | WBPhenotype:0000127 | Paper_evidence | WBPaper00031997 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not recover significantly faster than wild type under the same conditions. | Paper_evidence | WBPaper00031997 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031997 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000032 | PATO:0000460 | Paper_evidence | WBPaper00031997 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Dauers were induced by pheromone. | Paper_evidence | WBPaper00031997 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00031997 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000395 | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Oocytes and sperm are functional | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000977 | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00012645 | ||||||||
WBPaper00038400 | |||||||||
WBPaper00031997 | |||||||||
WBPaper00014159 | |||||||||
WBPaper00014700 | |||||||||
WBPaper00001423 | |||||||||
WBPaper00017752 | |||||||||
WBPaper00012632 | |||||||||
WBPaper00014629 | |||||||||
WBPaper00001007 | |||||||||
Method | Substitution_allele |