WormBase Tree Display for Variation: WBVar00240848
expand all nodes | collapse all nodes | view schema
| WBVar00240848 | Evidence | Paper_evidence | WBPaper00002627 | ||
|---|---|---|---|---|---|
| Name | Public_name | pkP5292 | |||
| Sequence_details | SMap | S_parent | Sequence | Y44A6D | |
| Flanking_sequences | taaggcatgcacagtttttctatcaatata | cacttaccgcagcgtcagccattttatcga | |||
| Mapping_target | Y44A6D | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Transposon_insertion | Tc1 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Laboratory | NL | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00012853 | |||
| WBGene00012852 | |||||
| Transcript | Y44A6D.2.1 | ||||
| Y44A6D.1.1 | |||||
| Genetics | Interpolated_map_position | V | 25.221 | ||
| Reference | WBPaper00002627 | ||||
| Remark | This insertion site was identified using sequence from a shotgun library of Tc1 flanks. It should be confirmed before it is studied further | Paper_evidence | WBPaper00002627 | ||
| Method | Transposon_insertion |
