WormBase Tree Display for Variation: WBVar00240765
expand all nodes | collapse all nodes | view schema
| WBVar00240765 | Evidence | Paper_evidence | WBPaper00002627 | ||
|---|---|---|---|---|---|
| Name | Public_name | pkP5143 | |||
| Sequence_details | SMap | S_parent | Sequence | Y48D7A | |
| Flanking_sequences | aatagtcttttttgtgtctgaacgggctga | aattatgtttttttttgaatgaaaaatctt | |||
| Mapping_target | Y48D7A | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Transposon_insertion | Tc1 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Laboratory | NL | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00001461 | |||
| Transcript | Y48D7A.2.2 | ||||
| Genetics | Interpolated_map_position | X | -12.6546 | ||
| Reference | WBPaper00002627 | ||||
| Remark | This insertion site was identified using sequence from a shotgun library of Tc1 flanks. It should be confirmed before it is studied further | Paper_evidence | WBPaper00002627 | ||
| Method | Transposon_insertion |
