WormBase Tree Display for Variation: WBVar00240356
expand all nodes | collapse all nodes | view schema
| WBVar00240356 | Evidence | Paper_evidence | WBPaper00002627 | ||
|---|---|---|---|---|---|
| Name | Public_name | pkP937 | |||
| Sequence_details | SMap | S_parent | Sequence | C01F4 | |
| Flanking_sequences | gtcttgttttccttatttttcttctaccaa | tatatgcctcaaaattggtgtagtcatgat | |||
| Mapping_target | C01F4 | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Transposon_insertion | Tc1 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Laboratory | NL | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00015303 | |||
| Transcript | C01F4.2b.1 | ||||
| C01F4.2a.1 | |||||
| Genetics | Interpolated_map_position | I | -0.695842 | ||
| Reference | WBPaper00002627 | ||||
| Remark | This insertion site was identified using sequence from a shotgun library of Tc1 flanks. It should be confirmed before it is studied further | Paper_evidence | WBPaper00002627 | ||
| Method | Transposon_insertion |
