WormBase Tree Display for Variation: WBVar00240257
expand all nodes | collapse all nodes | view schema
| WBVar00240257 | Evidence | Paper_evidence | WBPaper00002627 | ||
|---|---|---|---|---|---|
| Name | Public_name | pkP689 | |||
| Sequence_details | SMap | S_parent | Sequence | T04A8 | |
| Flanking_sequences | ttggcaacgtgattctaatgttggcgattc | cgtatttctgacgcaaaattgataacttct | |||
| Mapping_target | T04A8 | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Transposon_insertion | Tc1 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00004526 | ||||
| Laboratory | NL | ||||
| Author | Korswagen RC | ||||
| Smits MT | |||||
| Durbin RM | |||||
| Plasterk RHA | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00011407 | |||
| WBGene00045118 | |||||
| Transcript | T04A8.17 | ||||
| T04A8.5.1 | |||||
| Genetics | Interpolated_map_position | III | -2.91363 | ||
| Reference | WBPaper00015325 | ||||
| Remark | This insertion site was identified using sequence from a shotgun library of Tc1 flanks. It should be confirmed before it is studied further | Paper_evidence | WBPaper00002627 | ||
| Method | Transposon_insertion |
