WormBase Tree Display for Variation: WBVar00240228
expand all nodes | collapse all nodes | view schema
WBVar00240228 | Evidence | Paper_evidence | WBPaper00002627 | ||
---|---|---|---|---|---|
Name | Public_name | pkP652 | |||
Sequence_details | SMap | S_parent | Sequence | T28B8 | |
Flanking_sequences | agaagaagttcagcaattgatttagaggat | aaaagtaagtggaatggatacaatttatac | |||
Mapping_target | T28B8 | ||||
Type_of_mutation | Insertion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Transposon_insertion | Tc1 | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00004526 | ||||
Laboratory | NL | ||||
Author | Korswagen RC | ||||
Smits MT | |||||
Durbin RM | |||||
Plasterk RHA | |||||
Status | Live | ||||
Affects | Gene | WBGene00012114 | |||
Transcript | T28B8.3a.1 | ||||
T28B8.3b.1 | |||||
Genetics | Interpolated_map_position | I | 2.60653 | ||
Reference | WBPaper00015325 | ||||
Remark | This insertion site was identified using sequence from a shotgun library of Tc1 flanks. It should be confirmed before it is studied further | Paper_evidence | WBPaper00002627 | ||
Method | Transposon_insertion |