WormBase Tree Display for Variation: WBVar00240228
expand all nodes | collapse all nodes | view schema
| WBVar00240228 | Evidence | Paper_evidence | WBPaper00002627 | ||
|---|---|---|---|---|---|
| Name | Public_name | pkP652 | |||
| Sequence_details | SMap | S_parent | Sequence | T28B8 | |
| Flanking_sequences | agaagaagttcagcaattgatttagaggat | aaaagtaagtggaatggatacaatttatac | |||
| Mapping_target | T28B8 | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Transposon_insertion | Tc1 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00004526 | ||||
| Laboratory | NL | ||||
| Author | Korswagen RC | ||||
| Smits MT | |||||
| Durbin RM | |||||
| Plasterk RHA | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00012114 | |||
| Transcript | T28B8.3a.1 | ||||
| T28B8.3b.1 | |||||
| Genetics | Interpolated_map_position | I | 2.60653 | ||
| Reference | WBPaper00015325 | ||||
| Remark | This insertion site was identified using sequence from a shotgun library of Tc1 flanks. It should be confirmed before it is studied further | Paper_evidence | WBPaper00002627 | ||
| Method | Transposon_insertion |
