WormBase Tree Display for Variation: WBVar00240199
expand all nodes | collapse all nodes | view schema
| WBVar00240199 | Evidence | Paper_evidence | WBPaper00002627 | ||
|---|---|---|---|---|---|
| Name | Public_name | WBVar00240199 | |||
| Other_name | pkP613 | ||||
| Sequence_details | SMap | S_parent | Sequence | C09G5 | |
| Flanking_sequences | gaaatcttgatcaatgctgcatattagaac | agaactttagccattcaatcacaatatgaa | |||
| Mapping_target | C09G5 | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Transposon_insertion | Tc1 | |||
| Natural_variant | |||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00033541 | ||||
| Laboratory | NL | ||||
| Author | Korswagen RC | ||||
| Smits MT | |||||
| Durbin RM | |||||
| Plasterk RHA | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00206538 | |||
| Transcript | C09G5.13.1 | ||||
| Genetics | Interpolated_map_position | II | 3.12429 | ||
| Reference | WBPaper00015325 | ||||
| Remark | This insertion site was identified using sequence from a shotgun library of Tc1 flanks. It should be confirmed before it is studied further | Paper_evidence | WBPaper00002627 | ||
| Method | Transposon_insertion |
