WormBase Tree Display for Variation: WBVar00239440
expand all nodes | collapse all nodes | view schema
| WBVar00239440 | Evidence | Paper_evidence | WBPaper00029257 | ||
|---|---|---|---|---|---|
| Name | Public_name | pk2299 | |||
| Other_name | F55A4.5.1:c.262C>T | ||||
| CE11107:p.Arg88Ter | |||||
| HGVSg | CHROMOSOME_X:g.1034310G>A | ||||
| Sequence_details | SMap | S_parent | Sequence | F55A4 | |
| Flanking_sequences | GCGTTCATAAAATAAAAATTCCAGATAGCT | GATTCAACAAGCTGCGGCACGTTTACAATT | |||
| Mapping_target | F55A4 | ||||
| Type_of_mutation | Substitution | C | T | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Laboratory | NL | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00018857 | |||
| Transcript | F55A4.5.1 | VEP_consequence | stop_gained | ||
| VEP_impact | HIGH | ||||
| HGVSc | F55A4.5.1:c.262C>T | ||||
| HGVSp | CE11107:p.Arg88Ter | ||||
| cDNA_position | 362 | ||||
| CDS_position | 262 | ||||
| Protein_position | 88 | ||||
| Exon_number | 4/13 | ||||
| Codon_change | Cga/Tga | ||||
| Amino_acid_change | R/* | ||||
| Genetics | Interpolated_map_position | X | -18.8083 | ||
| Reference | WBPaper00029257 | ||||
| Remark | well:4-h16, gene:F55A4.5, position:1935, change:R88X | ||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00018857 Nonsense | |||||
| Method | Substitution_allele |
