WormBase Tree Display for Variation: WBVar00239323
expand all nodes | collapse all nodes | view schema
WBVar00239323 | Evidence | Paper_evidence | WBPaper00031936 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | pk610 | |||||||
Other_name (2) | |||||||||
HGVSg | CHROMOSOME_IV:g.10406904_10407864del | ||||||||
Sequence_details | SMap | S_parent | Sequence | R10H10 | |||||
Flanking_sequences | aaaacaacaggaataacagaagttttgttt | caaagaccagaaaaagattttttcccgagt | |||||||
Mapping_target | R10H10 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00001669 | |||||||
Transcript | R10H10.5.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | R10H10.5.1:c.565_933-276del | ||||||||
cDNA_position | 576-? | ||||||||
CDS_position | 565-? | ||||||||
Protein_position | 189-? | ||||||||
Intron_number | 5-7/8 | ||||||||
Exon_number | 5-7/9 | ||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | IV | 4.5874 | ||||||
Mapping_data | In_multi_point | 4373 | |||||||
Description | Phenotype (19) | ||||||||
Phenotype_not_observed | WBPhenotype:0001414 | Paper_evidence | WBPaper00003465 | ||||||
Curator_confirmed | WBPerson291 | ||||||||
WBPhenotype:0001434 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals with mutations in individual G protein subunits respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
Reference | WBPaper00043908 | ||||||||
WBPaper00031936 | |||||||||
WBPaper00003465 | |||||||||
WBPaper00030770 | |||||||||
Method | Deletion_allele |