WormBase Tree Display for Variation: WBVar00239276
expand all nodes | collapse all nodes | view schema
WBVar00239276 | Name | Public_name | pk322 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | pk322te | ||||||||
HGVSg | CHROMOSOME_X:g.9247183_9249117del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F18G5 | |||||
Flanking_sequences | aatttattgcttctcggatccggtgaatct | tcacaatgttttgcatgtcaaaaaatttaa | |||||||
Mapping_target | F18G5 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00028908 | ||||||||
WBStrain00028911 | |||||||||
Laboratory | NL | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001674 | |||||||
Transcript | F18G5.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
cDNA_position | 131-? | ||||||||
CDS_position | 121-? | ||||||||
Protein_position | 41-? | ||||||||
Intron_number | 3-8/9 | ||||||||
Exon_number | 3-10/10 | ||||||||
F18G5.3.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
cDNA_position | 193-? | ||||||||
CDS_position | 121-? | ||||||||
Protein_position | 41-? | ||||||||
Intron_number | 4-9/10 | ||||||||
Exon_number | 4-11/11 | ||||||||
Interactor | WBInteraction000501260 | ||||||||
WBInteraction000503976 | |||||||||
WBInteraction000534901 | |||||||||
WBInteraction000534905 | |||||||||
WBInteraction000534906 | |||||||||
Isolation | Transposon_excision | Tc1 | |||||||
Genetics | Interpolated_map_position | X | 0.934375 | ||||||
Mapping_data | In_multi_point | 4378 | |||||||
Description | Phenotype (14) | ||||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00028856 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The average size, fluorescence level and number of SNB-1::CFP puncta in cholinergic motor neurons was not significantly different from wildtype. | Paper_evidence | WBPaper00028856 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | SNB-1::CFP | Paper_evidence | WBPaper00028856 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00028856 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | UNC-13::YFP puncta distribution is similar to wildtype in the dorsal cord. | Paper_evidence | WBPaper00028856 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | UNC-13S::YFP | Paper_evidence | WBPaper00028856 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000680 | Paper_evidence | WBPaper00028856 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Paralysis to 1mM aldicarb is indistinguishable from wild type as measured by the percent paralyzed over time. Heat shocked animals were slightly hypersensitive. Does not suppress aldicarb hypersensitivity due to constitutively active GPA-12 (Q205L). | Paper_evidence | WBPaper00028856 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00028856 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000845 | Paper_evidence | WBPaper00028856 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | This mutation has no effect on the time course of paralysis induced by 100uM levamisole compared to wildtype. | Paper_evidence | WBPaper00028856 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00028856 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001725 | Paper_evidence | WBPaper00033094 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | gpa-12 is not required for transgene expression upon osmotic stress (Fig S4D) | Paper_evidence | WBPaper00033094 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | frIs7 [pnlp-29::GFP] | Paper_evidence | WBPaper00033094 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals with mutations in individual G protein subunits respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001838 | Paper_evidence | WBPaper00033094 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The PMA-induced upregulation of pnlp-29::GFP expression was normal in mutant worms | Paper_evidence | WBPaper00033094 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | frIs7 [pnlp-29::GFP] | Paper_evidence | WBPaper00033094 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00043908 | ||||||||
WBPaper00031936 | |||||||||
WBPaper00033094 | |||||||||
WBPaper00028856 | |||||||||
WBPaper00049131 | |||||||||
WBPaper00065833 | |||||||||
Method | Deletion_allele |