WormBase Tree Display for Variation: WBVar00239267
expand all nodes | collapse all nodes | view schema
WBVar00239267 | Evidence | Paper_evidence | WBPaper00005150 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | pk298 | |||||||
Other_name | pk298te | ||||||||
K02A4.2.2:c.-18-582_83+37del | |||||||||
K02A4.2.3:c.-18-582_83+37del | |||||||||
HGVSg | CHROMOSOME_X:g.12882292_12883011del | ||||||||
Sequence_details | SMap | S_parent | Sequence | K02A4 | |||||
Flanking_sequences | aattattaaaaattaacatttttctggcca | gagaataggtatctatttttagtattgcta | |||||||
Mapping_target | K02A4 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00001681 | |||||||
Transcript (3) | |||||||||
Interactor | WBInteraction000502742 | ||||||||
Genetics | Interpolated_map_position | X | 8.81488 | ||||||
Mapping_data | In_multi_point | 5508 | |||||||
Description | Phenotype (17) | ||||||||
Phenotype_not_observed | WBPhenotype:0000535 | Paper_evidence | WBPaper00005150 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00005150 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00005150 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00005150 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | ten minute timepoint for assays | Paper_evidence | WBPaper00005150 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001435 | Paper_evidence | WBPaper00005150 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | ten minute timepoint for assays | Paper_evidence | WBPaper00005150 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001442 | Paper_evidence | WBPaper00005150 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | ten minute timepoint for assays | Paper_evidence | WBPaper00005150 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001484 | Paper_evidence | WBPaper00005150 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | ten minute timepoint for assays | Paper_evidence | WBPaper00005150 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals with mutations in individual G protein subunits respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001817 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited enhanced-gustatory plasticity, i.e. strong avoidance to NaCl after starvation, similar to that observed for wild type. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00043908 | ||||||||
WBPaper00031936 | |||||||||
WBPaper00032335 | |||||||||
WBPaper00005150 | |||||||||
Method | Deletion_allele |