WormBase Tree Display for Variation: WBVar00146336
expand all nodes | collapse all nodes | view schema
WBVar00146336 | Name | Public_name | gm104 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | Y50D4C.1c.1:c.71G>A | ||||||||
Y50D4C.1b.1:c.29G>A | |||||||||
CE43197:p.Trp24Ter | |||||||||
CE33232:p.Trp10Ter | |||||||||
Y50D4C.1a.1:c.71G>A | |||||||||
CE50871:p.Trp24Ter | |||||||||
Y50D4C.1d.1:c.41G>A | |||||||||
CE50774:p.Trp14Ter | |||||||||
HGVSg | CHROMOSOME_V:g.985161G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y50D4C | |||||
Flanking_sequences | tgatgacctacaacgaatcgacaaaaggat | ggtactactcggcggaaatgatgattcaat | |||||||
Mapping_target | Y50D4C | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00036239 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00006770 | |||||||
Transcript | Y50D4C.1d.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y50D4C.1d.1:c.41G>A | ||||||||
HGVSp | CE50774:p.Trp14Ter | ||||||||
cDNA_position | 41 | ||||||||
CDS_position | 41 | ||||||||
Protein_position | 14 | ||||||||
Exon_number | 1/6 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Y50D4C.1a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y50D4C.1a.1:c.71G>A | ||||||||
HGVSp | CE43197:p.Trp24Ter | ||||||||
cDNA_position | 71 | ||||||||
CDS_position | 71 | ||||||||
Protein_position | 24 | ||||||||
Exon_number | 2/8 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Y50D4C.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y50D4C.1b.1:c.29G>A | ||||||||
HGVSp | CE33232:p.Trp10Ter | ||||||||
cDNA_position | 29 | ||||||||
CDS_position | 29 | ||||||||
Protein_position | 10 | ||||||||
Exon_number | 1/3 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Y50D4C.1c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y50D4C.1c.1:c.71G>A | ||||||||
HGVSp | CE50871:p.Trp24Ter | ||||||||
cDNA_position | 71 | ||||||||
CDS_position | 71 | ||||||||
Protein_position | 24 | ||||||||
Exon_number | 2/4 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000521267 | ||||||||
WBInteraction000521268 | |||||||||
Genetics | Interpolated_map_position | V | -19.8831 | ||||||
Description | Phenotype | WBPhenotype:0000230 | Paper_evidence | WBPaper00002978 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Low | 4 percent | Paper_evidence | WBPaper00002978 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000406 | Paper_evidence | WBPaper00002978 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Low | 1 percent | Paper_evidence | WBPaper00002978 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00002978 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Complete | 100 percent | Paper_evidence | WBPaper00002978 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000882 | Paper_evidence | WBPaper00056964 | |||||||
Curator_confirmed | WBPerson48777 | ||||||||
Remark | Primary dendrite outgrowth reduced. Fig S2A (Not cell autonomous) | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
3° dendrites that fail to self-avoid and overgrow one another. Fig 3C. (Cell autonomous) | Paper_evidence | WBPaper00056964 | |||||||
Curator_confirmed | WBPerson48777 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00056964 | ||||
Curator_confirmed | WBPerson48777 | ||||||||
Phenotype_assay (3) | |||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | unc-34 mutants had perturbations in AC invasion | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002259 | Paper_evidence | WBPaper00056964 | |||||||
Curator_confirmed | WBPerson48777 | ||||||||
Remark | Reduced number of secondary dendrites. Fig S2B. (Not cell-autonomous) | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00056964 | ||||
Curator_confirmed | WBPerson48777 | ||||||||
Phenotype_assay (3) | |||||||||
Phenotype_not_observed | WBPhenotype:0000006 | Paper_evidence | WBPaper00002978 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000163 | Paper_evidence | WBPaper00002978 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00002978 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Reference | WBPaper00032446 | ||||||||
WBPaper00002978 | |||||||||
WBPaper00036239 | |||||||||
WBPaper00045955 | |||||||||
WBPaper00056964 | |||||||||
Method | Substitution_allele |