WormBase Tree Display for Variation: WBVar00146319
expand all nodes | collapse all nodes | view schema
WBVar00146319 | Name | Public_name | gm39 | ||||
---|---|---|---|---|---|---|---|
Other_name (2) | |||||||
HGVSg | CHROMOSOME_III:g.9172117C>G | ||||||
Sequence_details | SMap | S_parent | Sequence | F54G8 | |||
Flanking_sequences | gaaacacgtggcagaacggtgcatccattg | gaaagaatgatcagttgttggcctcaacga | |||||
Mapping_target | F54G8 | ||||||
Type_of_mutation | Substitution | g | m | Paper_evidence | WBPaper00002850 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00028732 | ||||||
Laboratory | NG | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00002081 | |||||
Transcript | F54G8.3.1 (12) | ||||||
Genetics | Interpolated_map_position | III | 0.282128 | ||||
Description | Phenotype (9) | ||||||
Phenotype_not_observed | WBPhenotype:0000220 | Paper_evidence | WBPaper00038447 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals did not have alterations in vulval fate specification. | Paper_evidence | WBPaper00038447 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000241 | Paper_evidence | WBPaper00004897 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | No accumulation of dead cell corpses | Paper_evidence | WBPaper00004897 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Disease_info | Models_disease | DOID:162 | |||||
DOID:1826 | |||||||
Models_disease_in_annotation | WBDOannot00000552 | ||||||
WBDOannot00001338 | |||||||
Reference | WBPaper00015090 | ||||||
WBPaper00038447 | |||||||
WBPaper00004897 | |||||||
WBPaper00035198 | |||||||
WBPaper00032026 | |||||||
WBPaper00035117 | |||||||
WBPaper00050116 | |||||||
WBPaper00055000 | |||||||
Method | Substitution_allele |