WormBase Tree Display for Variation: WBVar00146319
expand all nodes | collapse all nodes | view schema
WBVar00146319 | Name (3) | ||||||||
---|---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | F54G8 | |||||
Flanking_sequences | gaaacacgtggcagaacggtgcatccattg | gaaagaatgatcagttgttggcctcaacga | |||||||
Mapping_target | F54G8 | ||||||||
Type_of_mutation | Substitution | g | m | Paper_evidence | WBPaper00002850 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00028732 | ||||||||
Laboratory | NG | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002081 | |||||||
Transcript | F54G8.3.1 (12) | ||||||||
Genetics | Interpolated_map_position | III | 0.282128 | ||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed a strong response to aldicarb than ina-1(gm144) animals, in addition to being hypersensitive compared to wild-type animals. | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000104 | Paper_evidence | WBPaper00035117 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | ina-1(gm39) mutant ACs had significant reductions in the polarized distribution and membrane localization of UNC-40 and other invasive membrane components | Paper_evidence | WBPaper00035117 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035117 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000120 | Paper_evidence | WBPaper00035117 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | There was a greater than four-fold loss in the total volume and amount of the dense F-actin network in ina-1(gm39) mutants | Paper_evidence | WBPaper00035117 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035117 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000571 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Synaptic vesicles are misaccumulated in GABAergic D-type motor neurons as assayed by gaps in the pattern of fluorescence of juIs1[Punc-25::SNB-1::GFP] labeled vesicles. | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005190 | PATO:0000460 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit anterior convulsions when treated with pentylenetetrazole(PTZ).This response was also stronger than that observed for ina-1(gm144) animals. | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000977 | Paper_evidence | WBPaper00032026 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | At the L4 stage, ina-1 mutant gonads were clearly ruptured, and the germ cells clustered around the developing vulva | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005785 | PATO:0000460 | Paper_evidence | WBPaper00032026 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00035117 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | ina-1(gm39) mutants had a significant invasion defect, with 50% of ACs showing a lack of invasion at the P6.p four-cell stage, and 22% failing to invade by the P6.p eight-cell stage | Paper_evidence | WBPaper00035117 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035117 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001911 | Paper_evidence | WBPaper00055000 | |||||||
WBPaper00050116 | |||||||||
Curator_confirmed | WBPerson1068 | ||||||||
EQ_annotations | GO_term | GO:0031103 | PATO:0001511 | Paper_evidence | WBPaper00050116 | ||||
Curator_confirmed | WBPerson1068 | ||||||||
WBPhenotype:0002066 | Paper_evidence | WBPaper00038447 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals harbouring a hypomorphic mutation in the integrin alpha-subunit, ina-1(gm39), had a weakly penetrant basement membrane gap positioning defect, with 13% of observed gaps showing an overexpanded boundary at the mid-L4 stage. | Paper_evidence | WBPaper00038447 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000220 | Paper_evidence | WBPaper00038447 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not have alterations in vulval fate specification. | Paper_evidence | WBPaper00038447 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000241 | Paper_evidence | WBPaper00004897 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No accumulation of dead cell corpses | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Disease_info | Models_disease | DOID:162 | |||||||
DOID:1826 | |||||||||
Models_disease_in_annotation (2) | |||||||||
Reference | WBPaper00015090 | ||||||||
WBPaper00038447 | |||||||||
WBPaper00004897 | |||||||||
WBPaper00035198 | |||||||||
WBPaper00032026 | |||||||||
WBPaper00035117 | |||||||||
WBPaper00050116 | |||||||||
WBPaper00055000 | |||||||||
Method | Substitution_allele |