WormBase Tree Display for Variation: WBVar00146251
expand all nodes | collapse all nodes | view schema
| WBVar00146251 | Name | Public_name | gk1039 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | W07E11.1a.1:c.1225-1819_1654-35del | ||||||
| W07E11.1b.1:c.1225-1819_1654-35del | |||||||
| HGVSg | CHROMOSOME_X:g.10093715_10096332del | ||||||
| Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_X | |||
| Flanking_sequences | acggaagaggtgggatctctcgaaaaacct | gtagagtgaacacagattgagcacttgatt | |||||
| Mapping_target | CHROMOSOME_X | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | gk1039_external | ||||||
| gk1039_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00037360 | ||||||
| Laboratory | VC | ||||||
| Person | WBPerson427 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001445 | |||||
| WBGene00012326 | |||||||
| Transcript | W07E11.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | W07E11.1a.1:c.1225-1819_1654-35del | ||||||
| Intron_number | 5-7/19 | ||||||
| Exon_number | 6-7/20 | ||||||
| W07E11.3b.1 | VEP_consequence | transcript_ablation | |||||
| VEP_impact | HIGH | ||||||
| Intron_number | 2-3/4 | ||||||
| Exon_number | 1-5/5 | ||||||
| W07E11.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | W07E11.1b.1:c.1225-1819_1654-35del | ||||||
| Intron_number | 5-7/20 | ||||||
| Exon_number | 6-7/21 | ||||||
| W07E11.3a.1 | VEP_consequence | transcript_ablation | |||||
| VEP_impact | HIGH | ||||||
| Intron_number | 2/3 | ||||||
| Exon_number | 1-4/4 | ||||||
| Isolation | Mutagen | UV/TMP | |||||
| Description | Phenotype | WBPhenotype:0001524 | Paper_evidence | WBPaper00050063 | |||
| Curator_confirmed | WBPerson34925 | ||||||
| Remark | decreased L4/A locomotion velocity and motile fraction of npr-1 mutants (suppression of the increased arousal during lethargus phenotype of npr-1 mutants) (Figure 1) | Paper_evidence | WBPaper00050063 | ||||
| Curator_confirmed | WBPerson34925 | ||||||
| Reference | WBPaper00050063 | ||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
