WormBase Tree Display for Variation: WBVar00146101
expand all nodes | collapse all nodes | view schema
WBVar00146101 | Name | Public_name | gk794 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | K06A1.1.1:c.275_713-52delinsCAATTCACAACAGTTCTTCA | ||||||||
HGVSg | CHROMOSOME_II:g.6455296_6455950delinsCAATTCACAACAGTTCTTCA | ||||||||
Sequence_details | SMap | S_parent | Sequence | K06A1 | |||||
Flanking_sequences | cagtgagcaattcacaacagttcttcaatg | attaacgctccataacgctcgtacttgtca | |||||||
Mapping_target | K06A1 | ||||||||
Type_of_mutation | Insertion | CAATTCACAACAGTTCTTCA | |||||||
Deletion | |||||||||
PCR_product | gk794_external | ||||||||
gk794_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00008308 | ||||||||
WBStrain00036781 | |||||||||
Laboratory | VC | ||||||||
Person | WBPerson427 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00019424 | |||||||
Transcript | K06A1.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | K06A1.1.1:c.275_713-52delinsCAATTCACAACAGTTCTTCA | ||||||||
cDNA_position | 278-? | ||||||||
CDS_position | 275-? | ||||||||
Protein_position | 92-? | ||||||||
Intron_number | 3-5/7 | ||||||||
Exon_number | 3-5/8 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000137 | Paper_evidence | WBPaper00049336 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
Remark | "flp-11, a neuropeptide gene, was strongly downregulated in aptf-1 mutant worms in both embryos and larvae (Figure 2A, Supplementary file 1, Table 1A and 1B)" | Paper_evidence | WBPaper00049336 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00049336 | ||||
Curator_confirmed | WBPerson38423 | ||||||||
WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00049336 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00049336 | |||||||
Curator_confirmed | WBPerson38423 | ||||||||
Remark | "flp-11 was expressed strongly in RIS and faintly in a few additional neurons. Expression was abolished or greatly reduced in RIS in aptf-1 mutant worms (Figure 2B, Figure 2-figure supplement 3)"; "Expression of mouse tfap2beta also partially restored the expression of flp-11 in aptf-1 mutant worms (Figure 2F, Figure2-figure supplement 4)" | Paper_evidence | WBPaper00049336 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Rescued_by_transgene | WBTransgene00022999 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005045 | PATO:0000460 | Paper_evidence | WBPaper00049336 | ||||
Curator_confirmed | WBPerson38423 | ||||||||
Phenotype_assay | Genotype | goeIs288[pflp-11::mKate2::unc-54 3'UTR, unc-119(+)] | Paper_evidence | WBPaper00049336 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00049336 | |||||||
WBPaper00057148 | |||||||||
Curator_confirmed | WBPerson38423 | ||||||||
WBPerson712 | |||||||||
Remark | aptf-1(gk794) mutant worms did not show normal nose immobility during quiescence as in wild type controls.; "Nose speed measurements during sleep showed that tfap2beta expression partially restored immobility (Figure 2D,E)"; "Whereas aptf-1 mutants without the transgene did not show any detectable immobility, the flp-11 transgene partially restored immobility (Figure 3A)" | Paper_evidence | WBPaper00049336 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
these RIS-defective animals were strikingly defective in head movement quiescence and also showed rocking movements: alternating backward and forward body movements, each resulting in less than a half-body translation of the worm's position and virtually no net movement in either direction. | Paper_evidence | WBPaper00057148 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Rescued_by_transgene | WBTransgene00022999 | ||||||||
WBTransgene00023003 | |||||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00049336 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Remark | "aptf-1 did not control the expression of unc-25 (Figure 1D)" | Paper_evidence | WBPaper00049336 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
"aptf-1 did not control the expression of the vesicular GABA transporter gene unc-47 (figure supplement 1B)" | Paper_evidence | WBPaper00049336 | |||||||
Curator_confirmed | WBPerson38423 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005045 | PATO:0000460 | Paper_evidence | WBPaper00049336 | ||||
Curator_confirmed | WBPerson38423 | ||||||||
Phenotype_assay | Genotype | juIs8[pSC382(unc-25::GFP)] | Paper_evidence | WBPaper00049336 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
oxIs12 [unc-47p::GFP+lin-15(+)] | Paper_evidence | WBPaper00049336 | |||||||
Curator_confirmed | WBPerson38423 | ||||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00057148 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | aptf-1(lf) mutants greatly reduced their frequency of body bends during lethargus to a level similar to that of N2 controls. | Paper_evidence | WBPaper00057148 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002432 | Paper_evidence | WBPaper00057148 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In contrast to ALA-defective animals, aptf-1(lf) mutants showed wild type body-bend quiescence during SIS; SIS body movement quiescence in aptf-1(lf) was similar to wild type, but took longer to set in in the case of UV-SIS (G). Body mobility was defined as a translation of the body position by at least 1/10 body length. | Paper_evidence | WBPaper00057148 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
We examined the behavior of aptf-1(lf) animals during SIS triggered by ultraviolet light (C) and by ingestion of pore-forming Cry5B toxin (D). As in lethargus, RIS-defective animals showed head movement, but they did not rock back and forth as they did during lethargus. Head mobility was defined as any discernible movement. Though head movement is often referred to as foraging behavior, we did not observe any feeding (pharyngeal pumping) in aptf-1 mutants in these assays. | Paper_evidence | WBPaper00057148 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00049336 | ||||||||
WBPaper00057148 | |||||||||
WBPaper00064927 | |||||||||
WBPaper00066004 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |