WormBase Tree Display for Variation: WBVar00145914
expand all nodes | collapse all nodes | view schema
| WBVar00145914 | Name | Public_name | gk546 | ||
|---|---|---|---|---|---|
| HGVSg | CHROMOSOME_I:g.12711354_12712161del | ||||
| Sequence_details | SMap | S_parent | Sequence | T06G6 | |
| Flanking_sequences | actaaccggggattttcgcttctccgcggc | aatttttgtttatttcagaagtaacattaa | |||
| Mapping_target | T06G6 | ||||
| Type_of_mutation | Deletion | ||||
| PCR_product | gk546_external | ||||
| gk546_internal | |||||
| SeqStatus | Sequenced | ||||
| Deletion_verification | PCR with one primer internal to the deletion and one external confirms that no WT copy of the gene remains. | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00036399 | ||||
| Laboratory | VC | ||||
| Person | WBPerson427 | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00011546 | |||
| WBGene00011545 | |||||
| Transcript | T06G6.4.1 | VEP_consequence | 3_prime_UTR_variant | ||
| VEP_impact | MODIFIER | ||||
| cDNA_position | 1096-? | ||||
| Exon_number | 12/12 | ||||
| T06G6.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||
| VEP_impact | HIGH | ||||
| cDNA_position | ?-195 | ||||
| CDS_position | ?-195 | ||||
| Protein_position | ?-65 | ||||
| Intron_number | 1/12 | ||||
| Exon_number | 1-2/13 | ||||
| T06G6.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||
| VEP_impact | HIGH | ||||
| cDNA_position | ?-195 | ||||
| CDS_position | ?-195 | ||||
| Protein_position | ?-65 | ||||
| Intron_number | 1/11 | ||||
| Exon_number | 1-2/12 | ||||
| Isolation | Mutagen | UV/TMP | |||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||
| Method | KO_consortium_allele |
