WormBase Tree Display for Variation: WBVar00145794
expand all nodes | collapse all nodes | view schema
| WBVar00145794 | Evidence | Paper_evidence | WBPaper00040857 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | gk388 | |||||
| HGVSg | CHROMOSOME_II:g.7616134_7616611del | ||||||
| Sequence_details | SMap | S_parent | Sequence | R07G3 | |||
| Flanking_sequences | gattcaaacttccgaccagttaccgatgaa | aaaataatttccgaatttcaggtcacagta | |||||
| Mapping_target | R07G3 | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | gk388_external | ||||||
| gk388_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00007532 | ||||||
| WBStrain00036158 | |||||||
| WBStrain00040280 | |||||||
| WBStrain00040547 | |||||||
| Laboratory | VC | ||||||
| Person | WBPerson427 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000390 | |||||
| Transcript | R07G3.1.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| Intron_number | 2/5 | ||||||
| Exon_number | 1-2/6 | ||||||
| Interactor | WBInteraction000520142 | ||||||
| Isolation | Mutagen | TMP/UV | |||||
| Description | Phenotype | WBPhenotype:0000059 | Paper_evidence | WBPaper00045004 | |||
| Curator_confirmed | WBPerson3744 | ||||||
| Rescued_by_transgene | WBTransgene00019772 | ||||||
| WBPhenotype:0000729 | Paper_evidence | WBPaper00045004 | |||||
| Curator_confirmed | WBPerson3744 | ||||||
| Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Mutants showed normal localization of SNB-1::VENUS in the RIA neuron. | Paper_evidence | WBPaper00040857 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00040857 | ||||||
| WBPaper00045004 | |||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
