WormBase Tree Display for Variation: WBVar00145684
expand all nodes | collapse all nodes | view schema
WBVar00145684 | Name | Public_name | gk277 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F22E12.4b.2:c.91_205-421del | ||||||||
F22E12.4b.1:c.91_205-421del | |||||||||
F22E12.4a.1:c.91_205-421del | |||||||||
F22E12.4d.1:c.91_205-421del | |||||||||
F22E12.4b.3:c.91_205-421del | |||||||||
HGVSg | CHROMOSOME_V:g.10468959_10469979del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F22E12 | |||||
Flanking_sequences | tgaataattattcagatgctcagtcaacca | cttttctagacacgtccatcaacaacatgc | |||||||
Mapping_target | F22E12 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | gk277_external | ||||||||
gk277_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035885 | ||||||||
WBStrain00040830 | |||||||||
Laboratory | VC | ||||||||
Person | WBPerson427 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001178 | |||||||
Transcript | F22E12.4b.3 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F22E12.4b.3:c.91_205-421del | ||||||||
cDNA_position | 91-? | ||||||||
CDS_position | 91-? | ||||||||
Protein_position | 31-? | ||||||||
Intron_number | 2/10 | ||||||||
Exon_number | 2/11 | ||||||||
F22E12.4b.2 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F22E12.4b.2:c.91_205-421del | ||||||||
cDNA_position | 97-? | ||||||||
CDS_position | 91-? | ||||||||
Protein_position | 31-? | ||||||||
Intron_number | 3/8 | ||||||||
Exon_number | 3/9 | ||||||||
F22E12.4a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F22E12.4a.1:c.91_205-421del | ||||||||
cDNA_position | 99-? | ||||||||
CDS_position | 91-? | ||||||||
Protein_position | 31-? | ||||||||
Intron_number | 3/11 | ||||||||
Exon_number | 3/12 | ||||||||
F22E12.4b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F22E12.4b.1:c.91_205-421del | ||||||||
cDNA_position | 99-? | ||||||||
CDS_position | 91-? | ||||||||
Protein_position | 31-? | ||||||||
Intron_number | 3/10 | ||||||||
Exon_number | 3/11 | ||||||||
F22E12.4d.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F22E12.4d.1:c.91_205-421del | ||||||||
cDNA_position | 99-? | ||||||||
CDS_position | 91-? | ||||||||
Protein_position | 31-? | ||||||||
Intron_number | 3/10 | ||||||||
Exon_number | 3/11 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Description | Phenotype | WBPhenotype:0000384 | Paper_evidence | WBPaper00031981 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed axon-pathfinding defects along the ventral midline. | Paper_evidence | WBPaper00031981 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031981 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006976 | PATO:0000460 | Paper_evidence | WBPaper00031981 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000135 | Paper_evidence | WBPaper00035158 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Deletion of the MYND domain in egl-9(gk277) animals had no significant effect on the ability of EGL-9 to inhibit HIF-1 transcriptional activity | Paper_evidence | WBPaper00035158 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Real time PCR for K10H10.2 mRNA | Paper_evidence | WBPaper00035158 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | nhr-57p::GFP | Paper_evidence | WBPaper00035158 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00035158 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HIF-1 protein levels were not significantly higher in egl-9(gk277), relative to animals containing the wild-type egl-9 gene | Paper_evidence | WBPaper00035158 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Western blots | Paper_evidence | WBPaper00035158 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00031981 | ||||||||
WBPaper00035158 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |