WormBase Tree Display for Variation: WBVar00145298

WBVar00145298 Name: Public_name: ez16
    Other_name: B0286.1.2:c.415-337C>T
      B0286.5.1:c.3G>A
      CE03865:p.Met1?
      B0286.1.1:c.415-337C>T
    HGVSg: CHROMOSOME_II:g.4383286C>T
  Sequence_details: SMap: S_parent: Sequence: B0286
    Flanking_sequences: ccccctaccataaaaaaatacaataatcat actcgccatcaaacacatcttccatttcat
    Mapping_target: B0286
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00006485
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00006445
    Laboratory: DZ
    Status: Live
  Affects: Gene: WBGene00015115
      WBGene00001438
    Transcript: B0286.1.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: B0286.1.1:c.415-337C>T
        Intron_number: 5/8
      B0286.5.1 (12)
      B0286.1.2 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: B0286.1.2:c.415-337C>T
        Intron_number: 6/9
    Interactor: WBInteraction000504413
  Genetics: Interpolated_map_position: II -4.72869
  Remark: Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001438 Missense 1 M to I Paper_evidence: WBPaper00006485
    Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00015115 Intron Inferred_automatically map_alleles.pl
  Method: Substitution_allele