WormBase Tree Display for Variation: WBVar00145274
expand all nodes | collapse all nodes | view schema
| WBVar00145274 | Evidence | Paper_evidence | WBPaper00033006 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | ev701 | |||||||
| Other_name | CE17535:p.Cys848Tyr | ||||||||
| C37C3.6a.1:c.2543G>A | |||||||||
| CE30735:p.Cys848Tyr | |||||||||
| C37C3.6c.1:c.2543G>A | |||||||||
| C37C3.6b.1:c.2543G>A | |||||||||
| CE17536:p.Cys848Tyr | |||||||||
| C37C3.6a.2:c.2543G>A | |||||||||
| HGVSg | CHROMOSOME_V:g.7830748G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C37C3 | |||||
| Flanking_sequences | accgccgcctctggaaagggtaacgaaggat | cccatcgttcactcttggaggatgtaacga | |||||||
| Mapping_target | C37C3 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00033006 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00029130 | ||||||||
| Laboratory | NW | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003242 | |||||||
| Transcript | C37C3.6b.1 (12) | ||||||||
| C37C3.6a.2 (12) | |||||||||
| C37C3.6a.1 (12) | |||||||||
| C37C3.6c.1 (12) | |||||||||
| Interactor | WBInteraction000050625 | ||||||||
| Isolation | Mutagen | EMS | |||||||
| Genetics | Interpolated_map_position | V | 0.911393 | ||||||
| Description | Phenotype | WBPhenotype:0000195 | Paper_evidence | WBPaper00033006 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | mig-6 class-s mutations cause phase 2 DTC migration defects: heterozygous hermaphrodites show phase 2D (diagonal), phase 2V (ventral) and phase 2M (meandering) defects | Paper_evidence | WBPaper00033006 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | High | Paper_evidence | WBPaper00033006 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00033006 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Dominant_negative_gain_of_function | Paper_evidence | WBPaper00033006 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00033006 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000882 | Paper_evidence | WBPaper00056066 | |||||||
| Curator_confirmed | WBPerson18979 | ||||||||
| Remark | PVD 1° dendrite branch mispositioned | Paper_evidence | WBPaper00056066 | ||||||
| Curator_confirmed | WBPerson18979 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00056066 | ||||
| Curator_confirmed | WBPerson18979 | ||||||||
| GO_term | GO:0044307 | PATO:0000628 | Paper_evidence | WBPaper00056066 | |||||
| Curator_confirmed | WBPerson18979 | ||||||||
| Phenotype_not_observed | WBPhenotype:0001652 | Paper_evidence | WBPaper00039950 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | No invasion defect was observed. | Paper_evidence | WBPaper00039950 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001920 | Paper_evidence | WBPaper00037071 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Unlike et4 and sa580, this allele does not exhibit any twisted pharynx phenotype. | Paper_evidence | WBPaper00037071 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00039950 | ||||||||
| WBPaper00037071 | |||||||||
| WBPaper00033006 | |||||||||
| WBPaper00056066 | |||||||||
| Method | Substitution_allele |
